pycom15g09220
NAC Family

NAC domain-containing protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
N/A
Physical Location & Seq
Forward (+)
5937951 .. 5938184
234 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 234 bp
ATGTTGAGGACAATGCCACCACCACAGCTGCATCATCAAGGCCCTCCATCTATGAATCATCATCCTCAAGTGCAAGATATTACTAATACAGCCATGATGAACGGTCCAGATCATCAAGGTGGATATGGAACAATAGACATGAACAACAACAACAACGCAAATGGTGGGAGTGGAAACAGGTTTATGAACATGGAGCCTTGTGTTGATCTTGATAACTACTGGCCTCCCTATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

8.62

Weight (kDa)

5.5

Isoelectric Point (pI)

24.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 1 cut(s) 28
AluI AGCT 1 cut(s) 28
AoxI GGCC 2 cut(s) 40, 221
ApeKI GCWGC 1 cut(s) 28
AspS9I GGNCC 2 cut(s) 41, 104
AvaII GGWCC 1 cut(s) 104
BbvI GCAGC 1 cut(s) 15
BccI CCATC 1 cut(s) 55
BisI GCNGC 1 cut(s) 29
BlsI GCNGC 1 cut(s) 30
Bme18I GGWCC 1 cut(s) 104
BmgT120I GGNCC 2 cut(s) 41, 104
BmiI GGNNCC 1 cut(s) 195
BmsI GCATC 1 cut(s) 40
BpuEI CTTGAG 1 cut(s) 51
Bse1I ACTGG 1 cut(s) 224
BseGI GGATG 1 cut(s) 61
BseNI ACTGG 1 cut(s) 224
BseXI GCAGC 1 cut(s) 15
BshFI GGCC 2 cut(s) 42, 223
BsnI GGCC 2 cut(s) 42, 223
Bsp143I GATC 2 cut(s) 109, 205
BspANI GGCC 2 cut(s) 42, 223
BspLI GGNNCC 1 cut(s) 195
BsrI ACTGG 1 cut(s) 224
BssMI GATC 2 cut(s) 109, 205
Bst4CI ACNGT 1 cut(s) 104
BstF5I GGATG 1 cut(s) 61
BstKTI GATC 2 cut(s) 112, 208
BstMBI GATC 2 cut(s) 109, 205
BstV1I GCAGC 1 cut(s) 15
BsuRI GGCC 2 cut(s) 42, 223
BtsCI GGATG 1 cut(s) 61
Cfr13I GGNCC 2 cut(s) 41, 104
CviAII CATG 3 cut(s) 94, 139, 190
CviJI RGCY 5 cut(s) 28, 42, 92, 196, 223
CviKI_1 RGCY 5 cut(s) 28, 42, 92, 196, 223
DpnI GATC 2 cut(s) 111, 207
DpnII GATC 2 cut(s) 109, 205
Eco47I GGWCC 1 cut(s) 104
EcoO109I RGGNCCY 1 cut(s) 41
FaeI CATG 3 cut(s) 97, 142, 193
FaiI YATR 6 cut(s) 53, 95, 126, 140, 185, 191
FatI CATG 3 cut(s) 93, 138, 189
Fnu4HI GCNGC 1 cut(s) 29
FokI GGATG 1 cut(s) 48
Fsp4HI GCNGC 1 cut(s) 29
GluI GCNGC 1 cut(s) 29
HaeIII GGCC 2 cut(s) 42, 223
Hin1II CATG 3 cut(s) 97, 142, 193
HinfI GANTC 1 cut(s) 55
Hpy188III TCNNGA 2 cut(s) 107, 209
HpyCH4III ACNGT 1 cut(s) 104
HpyCH4V TGCA 2 cut(s) 31, 73
Hsp92II CATG 3 cut(s) 97, 142, 193
Kzo9I GATC 2 cut(s) 109, 205
LmnI GCTCC 1 cut(s) 193
LpnPI CCDG 3 cut(s) 120, 163, 205
Lsp1109I GCAGC 1 cut(s) 15
LweI GCATC 1 cut(s) 40
MalI GATC 2 cut(s) 111, 207
MboI GATC 2 cut(s) 109, 205
MnlI CCTC 3 cut(s) 54, 75, 234
MslI CAYNNNNRTG 1 cut(s) 117
MspA1I CMGCKG 1 cut(s) 28
NdeII GATC 2 cut(s) 109, 205
NlaIII CATG 3 cut(s) 97, 142, 193
NlaIV GGNNCC 1 cut(s) 195
PfeI GAWTC 1 cut(s) 55
PkrI GCNGC 1 cut(s) 30
PspN4I GGNNCC 1 cut(s) 195
PspPI GGNCC 2 cut(s) 41, 104
PvuII CAGCTG 1 cut(s) 28
RseI CAYNNNNRTG 1 cut(s) 117
SatI GCNGC 1 cut(s) 29
Sau3AI GATC 2 cut(s) 109, 205
Sau96I GGNCC 2 cut(s) 41, 104
SetI ASST 3 cut(s) 30, 121, 182
SfaNI GCATC 1 cut(s) 40
SinI GGWCC 1 cut(s) 104
SmiMI CAYNNNNRTG 1 cut(s) 117
SmlI CTYRAG 1 cut(s) 66
SmoI CTYRAG 1 cut(s) 66
TaaI ACNGT 1 cut(s) 104
TfiI GAWTC 1 cut(s) 55
TseI GCWGC 1 cut(s) 28
TspDTI ATGAA 4 cut(s) 68, 113, 155, 200
VpaK11BI GGWCC 1 cut(s) 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.