pycom15g10310

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
N/A
Physical Location & Seq
Forward (+)
6736378 .. 6736752
375 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 375 bp
ATGATGGAGCGCTTTTGGGTCTTGGAATTAGGCCCCACTATTTCAACATACAATTCTCTGGAAAAGGGCAGTTGCAAGGCTGGAGATCTTGTAGGGGCTAGTAAGATCCTTAAGACGATGAAAAGTCGGGGTACTGCCCGTACTCCAACAACCTATAACTATTTCTCTAGGAACTGTTCAAAGTATGGGAAAATTGAGGTTTATTGGACCTTTATACCAAAAGGATTGAATCTAGATGATCGATCGCTTACTTTCCCAACTTTGTTGGAGATGTTAAGTGTGGAGGGGAGATTGAATTTTGCTATTCAAGTTAGCAAGGAAATGATCGATCAAGGGGATGGGAGCTACAAGCAACATACTTTACAATATGCATAA

Protein Analysis

125

Amino Acids

14.08

Weight (kDa)

9.1

Isoelectric Point (pI)

20.07

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_2 PF13041 12 - 60 1.4e-06 PPR repeat family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 100
AcsI RAATTY 1 cut(s) 295
AfaI GTAC 2 cut(s) 133, 142
AfeI AGCGCT 1 cut(s) 11
AflII CTTAAG 1 cut(s) 110
AgsI TTSAA 5 cut(s) 45, 180, 229, 295, 308
AluBI AGCT 1 cut(s) 345
AluI AGCT 1 cut(s) 345
AlwI GGATC 1 cut(s) 100
Aor51HI AGCGCT 1 cut(s) 11
AoxI GGCC 1 cut(s) 31
ApoI RAATTY 1 cut(s) 295
AspLEI GCGC 1 cut(s) 12
AspS9I GGNCC 2 cut(s) 32, 207
AvaII GGWCC 1 cut(s) 207
BccI CCATC 1 cut(s) 332
BfaI CTAG 3 cut(s) 99, 168, 233
BfoI RGCGCY 1 cut(s) 13
BfrI CTTAAG 1 cut(s) 110
BglII AGATCT 1 cut(s) 85
Bme18I GGWCC 1 cut(s) 207
BmgT120I GGNCC 2 cut(s) 32, 207
BmiI GGNNCC 1 cut(s) 34
BpmI CTGGAG 1 cut(s) 102
Bsa29I ATCGAT 2 cut(s) 241, 327
BsaXI ACNNNNNCTCC 2 cut(s) 75, 105
BseCI ATCGAT 2 cut(s) 241, 327
BseGI GGATG 1 cut(s) 343
Bsh1285I CGRYCG 1 cut(s) 245
BshFI GGCC 1 cut(s) 33
BshVI ATCGAT 2 cut(s) 241, 327
BsiEI CGRYCG 1 cut(s) 245
BsnI GGCC 1 cut(s) 33
Bsp143I GATC 6 cut(s) 85, 105, 238, 242, 324, 328
BspANI GGCC 1 cut(s) 33
BspDI ATCGAT 2 cut(s) 241, 327
BspLI GGNNCC 1 cut(s) 34
BspPI GGATC 1 cut(s) 100
BspTI CTTAAG 1 cut(s) 110
BssMI GATC 6 cut(s) 85, 105, 238, 242, 324, 328
Bst4CI ACNGT 1 cut(s) 176
BstAFI CTTAAG 1 cut(s) 110
BstF5I GGATG 1 cut(s) 343
BstH2I RGCGCY 1 cut(s) 13
BstHHI GCGC 1 cut(s) 12
BstKTI GATC 6 cut(s) 88, 108, 241, 245, 327, 331
BstMBI GATC 6 cut(s) 85, 105, 238, 242, 324, 328
BstMCI CGRYCG 1 cut(s) 245
BstX2I RGATCY 2 cut(s) 85, 105
BstYI RGATCY 2 cut(s) 85, 105
Bsu15I ATCGAT 2 cut(s) 241, 327
BsuRI GGCC 1 cut(s) 33
BsuTUI ATCGAT 2 cut(s) 241, 327
BtsCI GGATG 1 cut(s) 343
CfoI GCGC 1 cut(s) 12
Cfr13I GGNCC 2 cut(s) 32, 207
ClaI ATCGAT 2 cut(s) 241, 327
Csp6I GTAC 2 cut(s) 132, 141
CviJI RGCY 4 cut(s) 33, 80, 98, 345
CviKI_1 RGCY 4 cut(s) 33, 80, 98, 345
CviQI GTAC 2 cut(s) 132, 141
DpnI GATC 6 cut(s) 87, 107, 240, 244, 326, 330
DpnII GATC 6 cut(s) 85, 105, 238, 242, 324, 328
Eco47I GGWCC 1 cut(s) 207
Eco47III AGCGCT 1 cut(s) 11
EcoO109I RGGNCCY 1 cut(s) 32
EcoT22I ATGCAT 1 cut(s) 373
FaiI YATR 7 cut(s) 49, 156, 186, 215, 357, 369, 373
FokI GGATG 1 cut(s) 350
FspBI CTAG 3 cut(s) 99, 168, 233
GlaI GCGC 1 cut(s) 11
GsuI CTGGAG 1 cut(s) 102
HaeII RGCGCY 1 cut(s) 13
HaeIII GGCC 1 cut(s) 33
HhaI GCGC 1 cut(s) 12
Hin6I GCGC 1 cut(s) 10
HinP1I GCGC 1 cut(s) 10
HinfI GANTC 1 cut(s) 229
Hpy188III TCNNGA 2 cut(s) 59, 233
HpyCH4III ACNGT 1 cut(s) 176
HpyCH4V TGCA 2 cut(s) 75, 371
HspAI GCGC 1 cut(s) 10
Kzo9I GATC 6 cut(s) 85, 105, 238, 242, 324, 328
LmnI GCTCC 2 cut(s) 7, 342
LpnPI CCDG 2 cut(s) 44, 66
MaeI CTAG 3 cut(s) 99, 168, 233
MalI GATC 6 cut(s) 87, 107, 240, 244, 326, 330
MboI GATC 6 cut(s) 85, 105, 238, 242, 324, 328
MflI RGATCY 2 cut(s) 85, 105
MluCI AATT 4 cut(s) 26, 52, 192, 295
MmeI TCCRAC 2 cut(s) 170, 246
MnlI CCTC 2 cut(s) 190, 277
Mph1103I ATGCAT 1 cut(s) 373
MseI TTAA 2 cut(s) 111, 275
MspCI CTTAAG 1 cut(s) 110
NdeII GATC 6 cut(s) 85, 105, 238, 242, 324, 328
NlaIV GGNNCC 1 cut(s) 34
NsiI ATGCAT 1 cut(s) 373
PfeI GAWTC 1 cut(s) 229
Ple19I CGATCG 1 cut(s) 245
PspN4I GGNNCC 1 cut(s) 34
PspPI GGNCC 2 cut(s) 32, 207
PsuI RGATCY 2 cut(s) 85, 105
PvuI CGATCG 1 cut(s) 245
RsaI GTAC 2 cut(s) 133, 142
RsaNI GTAC 2 cut(s) 132, 141
SaqAI TTAA 2 cut(s) 111, 275
Sau3AI GATC 6 cut(s) 85, 105, 238, 242, 324, 328
Sau96I GGNCC 2 cut(s) 32, 207
SetI ASST 4 cut(s) 155, 201, 212, 347
SinI GGWCC 1 cut(s) 207
SmlI CTYRAG 1 cut(s) 110
SmoI CTYRAG 1 cut(s) 110
Sse9I AATT 4 cut(s) 26, 52, 192, 295
SspMI CTAG 3 cut(s) 99, 168, 233
TaaI ACNGT 1 cut(s) 176
TaqI TCGA 2 cut(s) 241, 327
TasI AATT 4 cut(s) 26, 52, 192, 295
TfiI GAWTC 1 cut(s) 229
Tru1I TTAA 2 cut(s) 111, 275
Tru9I TTAA 2 cut(s) 111, 275
TspDTI ATGAA 1 cut(s) 134
Vha464I CTTAAG 1 cut(s) 110
VpaK11BI GGWCC 1 cut(s) 207
XapI RAATTY 1 cut(s) 295
XbaI TCTAGA 1 cut(s) 232
XspI CTAG 3 cut(s) 99, 168, 233
Zsp2I ATGCAT 1 cut(s) 373
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.