pycom15g12140

Introduces a single-strand break via transesterification at a target site in duplex DNA. Releases the supercoiling and torsional tension of DNA introduced during the DNA replication and transcription by transiently cleaving and rejoining one strand of the DNA duplex. The scissile phosphodiester is attacked by the catalytic tyrosine of the enzyme, resulting in the formation of a DNA-(5'-phosphotyrosyl)-enzyme intermediate and the expulsion of a 3'-OH DNA strand

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
N/A
Physical Location & Seq
Forward (+)
8271637 .. 8276560
4924 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 315 bp
ATGGGGAATGCTGTCTGGCTCCCTGGATCGGTATCAGAAGCAGCTGTAACAACTAACGTTTGCAACTCATGCACTCCAGGTCCTGTTTACTTGATTCAATTTACATTTCGGCGGCTAGAAATACCACCAAACTATAGTGCCAACCATTTGGGTTGCATTGGCGGCTGTGATGAGACTCTTAGACAGTTGACAGAAATCTGTGGAACTGGTTCTCGGTTATCAGTTGAGATTAATTGTAGAGTGTTGACTATTAGTCCAACTAAAGGTAACTTACATTCTTGTGGTTATATGCAAAACCAAACAGTCAAACGCTGA

Protein Analysis

105

Amino Acids

11.26

Weight (kDa)

8.22

Isoelectric Point (pI)

51.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 112, 162
AclI AACGTT 1 cut(s) 57
AclWI GGATC 1 cut(s) 34
AfiI CCNNNNNNNGG 2 cut(s) 28, 263
AgsI TTSAA 1 cut(s) 98
AhdI GACNNNNNGTC 1 cut(s) 252
AjnI CCWGG 2 cut(s) 22, 76
AluBI AGCT 1 cut(s) 44
AluI AGCT 1 cut(s) 44
Alw26I GTCTC 1 cut(s) 167
AlwI GGATC 1 cut(s) 34
AlwNI CAGNNNCTG 1 cut(s) 83
ApeKI GCWGC 1 cut(s) 41
AseI ATTAAT 1 cut(s) 231
Asp700I GAANNNNTTC 1 cut(s) 208
AspS9I GGNCC 1 cut(s) 80
AvaII GGWCC 1 cut(s) 80
BbvI GCAGC 1 cut(s) 53
BciT130I CCWGG 2 cut(s) 24, 78
BcoDI GTCTC 1 cut(s) 167
BfaI CTAG 1 cut(s) 116
BfmI CTRYAG 1 cut(s) 133
BisI GCNGC 3 cut(s) 42, 113, 163
BlsI GCNGC 3 cut(s) 43, 114, 164
Bme1390I CCNGG 2 cut(s) 24, 78
Bme18I GGWCC 1 cut(s) 80
BmeRI GACNNNNNGTC 1 cut(s) 252
BmgT120I GGNCC 1 cut(s) 80
BmiI GGNNCC 1 cut(s) 20
BmrFI CCNGG 2 cut(s) 24, 78
BpmI CTGGAG 1 cut(s) 60
BsaBI GATNNNNATC 1 cut(s) 31
BsaJI CCNNGG 1 cut(s) 22
Bsc4I CCNNNNNNNGG 2 cut(s) 28, 263
Bse1I ACTGG 1 cut(s) 211
Bse8I GATNNNNATC 1 cut(s) 31
BseBI CCWGG 2 cut(s) 24, 78
BseDI CCNNGG 1 cut(s) 22
BseJI GATNNNNATC 1 cut(s) 31
BseLI CCNNNNNNNGG 2 cut(s) 28, 263
BseNI ACTGG 1 cut(s) 211
BseXI GCAGC 1 cut(s) 53
BslI CCNNNNNNNGG 2 cut(s) 28, 263
BsmAI GTCTC 1 cut(s) 167
BsmI GAATGC 1 cut(s) 13
Bsp143I GATC 1 cut(s) 26
BspACI CCGC 2 cut(s) 112, 162
BspLI GGNNCC 1 cut(s) 20
BspPI GGATC 1 cut(s) 34
BsrI ACTGG 1 cut(s) 211
BssECI CCNNGG 1 cut(s) 22
BssMI GATC 1 cut(s) 26
Bst2UI CCWGG 2 cut(s) 24, 78
Bst4CI ACNGT 2 cut(s) 186, 304
BstAPI GCANNNNNTGC 1 cut(s) 69
BstDEI CTNAG 1 cut(s) 179
BstKTI GATC 1 cut(s) 29
BstMAI GTCTC 1 cut(s) 167
BstMBI GATC 1 cut(s) 26
BstMWI GCNNNNNNNGC 2 cut(s) 69, 162
BstNI CCWGG 2 cut(s) 24, 78
BstSCI CCNGG 2 cut(s) 22, 76
BstSFI CTRYAG 1 cut(s) 133
BstV1I GCAGC 1 cut(s) 53
BstXI CCANNNNNNTGG 1 cut(s) 148
CaiI CAGNNNCTG 1 cut(s) 83
Cfr13I GGNCC 1 cut(s) 80
CviAII CATG 1 cut(s) 69
CviJI RGCY 4 cut(s) 19, 44, 115, 165
CviKI_1 RGCY 4 cut(s) 19, 44, 115, 165
DdeI CTNAG 1 cut(s) 179
DpnI GATC 1 cut(s) 28
DpnII GATC 1 cut(s) 26
DriI GACNNNNNGTC 1 cut(s) 252
Eam1105I GACNNNNNGTC 1 cut(s) 252
Eco47I GGWCC 1 cut(s) 80
EcoO109I RGGNCCY 1 cut(s) 80
EcoRII CCWGG 2 cut(s) 22, 76
FaeI CATG 1 cut(s) 72
FaiI YATR 4 cut(s) 70, 135, 288, 290
FatI CATG 1 cut(s) 68
Fnu4HI GCNGC 3 cut(s) 42, 113, 163
Fsp4HI GCNGC 3 cut(s) 42, 113, 163
FspBI CTAG 1 cut(s) 116
GluI GCNGC 3 cut(s) 42, 113, 163
GsuI CTGGAG 1 cut(s) 60
Hin1II CATG 1 cut(s) 72
HincII GTYRAC 2 cut(s) 189, 246
HindII GTYRAC 2 cut(s) 189, 246
HinfI GANTC 2 cut(s) 94, 175
Hpy166II GTNNAC 3 cut(s) 88, 189, 246
Hpy188I TCNGA 1 cut(s) 37
Hpy8I GTNNAC 3 cut(s) 88, 189, 246
HpyCH4III ACNGT 2 cut(s) 186, 304
HpyCH4IV ACGT 1 cut(s) 57
HpyCH4V TGCA 4 cut(s) 63, 72, 156, 292
HpyF10VI GCNNNNNNNGC 2 cut(s) 69, 162
HpyF3I CTNAG 1 cut(s) 179
HpySE526I ACGT 1 cut(s) 57
Hsp92II CATG 1 cut(s) 72
Kzo9I GATC 1 cut(s) 26
LmnI GCTCC 1 cut(s) 24
LpnPI CCDG 6 cut(s) 9, 36, 63, 90, 96, 192
Lsp1109I GCAGC 1 cut(s) 53
MaeI CTAG 1 cut(s) 116
MaeII ACGT 1 cut(s) 57
MaeIII GTNAC 2 cut(s) 46, 266
MalI GATC 1 cut(s) 28
MboI GATC 1 cut(s) 26
MluCI AATT 2 cut(s) 98, 232
MlyI GAGTC 1 cut(s) 169
MmeI TCCRAC 1 cut(s) 281
MroXI GAANNNNTTC 1 cut(s) 208
MseI TTAA 1 cut(s) 231
MslI CAYNNNNRTG 1 cut(s) 279
MspA1I CMGCKG 1 cut(s) 44
MspR9I CCNGG 2 cut(s) 24, 78
Mva1269I GAATGC 1 cut(s) 13
MvaI CCWGG 2 cut(s) 24, 78
MwoI GCNNNNNNNGC 2 cut(s) 69, 162
NdeII GATC 1 cut(s) 26
NlaIII CATG 1 cut(s) 72
NlaIV GGNNCC 1 cut(s) 20
PctI GAATGC 1 cut(s) 13
PdmI GAANNNNTTC 1 cut(s) 208
PfeI GAWTC 1 cut(s) 94
PkrI GCNGC 3 cut(s) 43, 114, 164
PleI GAGTC 1 cut(s) 169
PpsI GAGTC 1 cut(s) 169
PpuMI RGGWCCY 1 cut(s) 80
PshBI ATTAAT 1 cut(s) 231
Psp1406I AACGTT 1 cut(s) 57
Psp5II RGGWCCY 1 cut(s) 80
Psp6I CCWGG 2 cut(s) 22, 76
PspGI CCWGG 2 cut(s) 22, 76
PspN4I GGNNCC 1 cut(s) 20
PspPI GGNCC 1 cut(s) 80
PspPPI RGGWCCY 1 cut(s) 80
PstNI CAGNNNCTG 1 cut(s) 83
PvuII CAGCTG 1 cut(s) 44
RseI CAYNNNNRTG 1 cut(s) 279
SaqAI TTAA 1 cut(s) 231
SatI GCNGC 3 cut(s) 42, 113, 163
Sau3AI GATC 1 cut(s) 26
Sau96I GGNCC 1 cut(s) 80
SchI GAGTC 1 cut(s) 169
ScrFI CCNGG 2 cut(s) 24, 78
SetI ASST 4 cut(s) 46, 60, 82, 268
SfcI CTRYAG 1 cut(s) 133
SinI GGWCC 1 cut(s) 80
SmiMI CAYNNNNRTG 1 cut(s) 279
Sse9I AATT 2 cut(s) 98, 232
SsiI CCGC 2 cut(s) 112, 162
SspMI CTAG 1 cut(s) 116
StyD4I CCNGG 2 cut(s) 22, 76
TaaI ACNGT 2 cut(s) 186, 304
TaiI ACGT 1 cut(s) 60
TasI AATT 2 cut(s) 98, 232
TauI GCSGC 2 cut(s) 115, 165
TfiI GAWTC 1 cut(s) 94
Tru1I TTAA 1 cut(s) 231
Tru9I TTAA 1 cut(s) 231
TseI GCWGC 1 cut(s) 41
VpaK11BI GGWCC 1 cut(s) 80
VspI ATTAAT 1 cut(s) 231
XmnI GAANNNNTTC 1 cut(s) 208
XspI CTAG 1 cut(s) 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.