pycom15g13070

2-alkenal reductase (NADP( )-dependent)-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
N/A
Physical Location & Seq
Forward (+)
8961548 .. 8962364
817 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 546 bp
ATGGCAGGAAATTGTGATGAATATGATGGCGCCATTTTGGTGAAGAATCTTTACTTGTCCTGTGATTCCTGCATGCGAGGCGTTAAGCACAGCGACGCCTCCACCACTGCCCAAGGTCGCATTGTTTTCTTTGCCACCGGCCAAGAGTACACTCTCATCACTAACACGGAAAGTTTCTTCAAAATCCACCACACCGATGTGCCTCTTTCCTACTACAATGGAATTTTAGGTCCTTGTACATGTATGGCTGGCATGACTGCTTATGCTGATTTATACGAAGTTTGTAAACCTAAGAAAGGAGACAAAGTGTACATCTCATCCGCATTTGGCGCTGTTGGTCAGATCGTCGGCCAATTTGCCAAACTCATGGGTTATTATGTTGTTGGAAGTGCTGGAAATCAAGAAAAGGTACCGACCCCACTTAGTTATTTAATCACAAGTTATTATGTTGTTGGAACTGCTCGATGCAGTGCTCATGAACATGAGACTTCATGGCCGCATTGCCGCGTGCGGGATGATCTCGCAATACAACTTCGAGGAGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
ADH_N_2 ADH_zinc_N

Protein Analysis

182

Amino Acids

19.78

Weight (kDa)

6.57

Isoelectric Point (pI)

19.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 409
AccB1I GGYRCC 2 cut(s) 29, 409
AccII CGCG 1 cut(s) 507
AciI CCGC 4 cut(s) 321, 497, 505, 511
AcoI YGGCCR 3 cut(s) 139, 349, 494
AcsI RAATTY 1 cut(s) 222
AcyI GRCGYC 2 cut(s) 30, 96
AfaI GTAC 4 cut(s) 149, 238, 311, 411
AfiI CCNNNNNNNGG 2 cut(s) 296, 511
AflIII ACRYGT 1 cut(s) 239
AgsI TTSAA 1 cut(s) 181
AleI CACNNNNGTG 1 cut(s) 197
Alw21I GWGCWC 1 cut(s) 475
Alw26I GTCTC 2 cut(s) 294, 479
AoxI GGCC 3 cut(s) 139, 349, 494
ApoI RAATTY 1 cut(s) 222
Asp718I GGTACC 1 cut(s) 409
AspLEI GCGC 2 cut(s) 32, 332
AspS9I GGNCC 1 cut(s) 230
AsuHPI GGTGA 1 cut(s) 52
AvaII GGWCC 1 cut(s) 230
BanI GGYRCC 2 cut(s) 29, 409
BarI GAAGNNNNNNTAC 2 cut(s) 35, 67
Bbv12I GWGCWC 1 cut(s) 475
BccI CCATC 1 cut(s) 20
BcoDI GTCTC 2 cut(s) 294, 479
BfoI RGCGCY 2 cut(s) 33, 333
BisI GCNGC 2 cut(s) 497, 505
BlsI GCNGC 2 cut(s) 498, 506
Bme18I GGWCC 1 cut(s) 230
BmgT120I GGNCC 1 cut(s) 230
BmiI GGNNCC 2 cut(s) 31, 411
BmsI GCATC 1 cut(s) 455
BsaHI GRCGYC 2 cut(s) 30, 96
BsaJI CCNNGG 1 cut(s) 112
BsaXI ACNNNNNCTCC 2 cut(s) 291, 321
Bsc4I CCNNNNNNNGG 2 cut(s) 296, 511
Bse118I RCCGGY 1 cut(s) 137
Bse3DI GCAATG 1 cut(s) 499
BseDI CCNNGG 1 cut(s) 112
BseGI GGATG 2 cut(s) 317, 520
BseLI CCNNNNNNNGG 2 cut(s) 296, 511
BseMI GCAATG 1 cut(s) 499
Bsh1236I CGCG 1 cut(s) 507
BshFI GGCC 3 cut(s) 141, 351, 496
BshNI GGYRCC 2 cut(s) 29, 409
BsiHKAI GWGCWC 1 cut(s) 475
BsiSI CCGG 1 cut(s) 138
BslI CCNNNNNNNGG 2 cut(s) 296, 511
BsmAI GTCTC 2 cut(s) 294, 479
BsnI GGCC 3 cut(s) 141, 351, 496
Bsp1286I GDGCHC 1 cut(s) 475
Bsp1407I TGTACA 2 cut(s) 236, 309
Bsp143I GATC 2 cut(s) 342, 517
BspACI CCGC 4 cut(s) 321, 497, 505, 511
BspANI GGCC 3 cut(s) 141, 351, 496
BspFNI CGCG 1 cut(s) 507
BspHI TCATGA 1 cut(s) 475
BspLI GGNNCC 2 cut(s) 31, 411
BspT107I GGYRCC 2 cut(s) 29, 409
BsrDI GCAATG 1 cut(s) 499
BsrFI RCCGGY 1 cut(s) 137
BsrGI TGTACA 2 cut(s) 236, 309
BssAI RCCGGY 1 cut(s) 137
BssECI CCNNGG 1 cut(s) 112
BssMI GATC 2 cut(s) 342, 517
BssNI GRCGYC 2 cut(s) 30, 96
BssT1I CCWWGG 1 cut(s) 112
BstACI GRCGYC 2 cut(s) 30, 96
BstAUI TGTACA 2 cut(s) 236, 309
BstC8I GCNNGC 3 cut(s) 74, 250, 509
BstDEI CTNAG 2 cut(s) 291, 422
BstENI CCTNNNNNAGG 1 cut(s) 294
BstF5I GGATG 2 cut(s) 317, 520
BstFNI CGCG 1 cut(s) 507
BstH2I RGCGCY 2 cut(s) 33, 333
BstHHI GCGC 2 cut(s) 32, 332
BstKTI GATC 2 cut(s) 345, 520
BstMAI GTCTC 2 cut(s) 294, 479
BstMBI GATC 2 cut(s) 342, 517
BstMWI GCNNNNNNNGC 2 cut(s) 78, 329
BstNSI RCATGY 2 cut(s) 76, 243
BstUI CGCG 1 cut(s) 507
BstXI CCANNNNNNTGG 1 cut(s) 367
BsuRI GGCC 3 cut(s) 141, 351, 496
BtsCI GGATG 2 cut(s) 317, 520
BtsI GCAGTG 2 cut(s) 105, 475
BtsIMutI CAGTG 2 cut(s) 105, 475
Cac8I GCNNGC 3 cut(s) 74, 250, 509
CciI TCATGA 1 cut(s) 475
CfoI GCGC 2 cut(s) 32, 332
Cfr10I RCCGGY 1 cut(s) 137
Cfr13I GGNCC 1 cut(s) 230
CseI GACGC 1 cut(s) 104
Csp6I GTAC 4 cut(s) 148, 237, 310, 410
CviAII CATG 8 cut(s) 73, 240, 253, 367, 476, 482, 492, 543
CviJI RGCY 4 cut(s) 141, 248, 351, 496
CviKI_1 RGCY 4 cut(s) 141, 248, 351, 496
CviQI GTAC 4 cut(s) 148, 237, 310, 410
DdeI CTNAG 2 cut(s) 291, 422
DinI GGCGCC 1 cut(s) 31
DpnI GATC 2 cut(s) 344, 519
DpnII GATC 2 cut(s) 342, 517
EaeI YGGCCR 3 cut(s) 139, 349, 494
Eco130I CCWWGG 1 cut(s) 112
Eco47I GGWCC 1 cut(s) 230
EcoNI CCTNNNNNAGG 1 cut(s) 294
EcoO109I RGGNCCY 1 cut(s) 230
EcoT14I CCWWGG 1 cut(s) 112
EgeI GGCGCC 1 cut(s) 31
EheI GGCGCC 1 cut(s) 31
ErhI CCWWGG 1 cut(s) 112
FaeI CATG 8 cut(s) 76, 243, 256, 370, 479, 485, 495, 546
FatI CATG 8 cut(s) 72, 239, 252, 366, 475, 481, 491, 542
FauI CCCGC 1 cut(s) 504
Fnu4HI GCNGC 2 cut(s) 497, 505
FokI GGATG 2 cut(s) 304, 527
Fsp4HI GCNGC 2 cut(s) 497, 505
GlaI GCGC 2 cut(s) 31, 331
GluI GCNGC 2 cut(s) 497, 505
HaeII RGCGCY 2 cut(s) 33, 333
HaeIII GGCC 3 cut(s) 141, 351, 496
HapII CCGG 1 cut(s) 138
HgaI GACGC 1 cut(s) 104
HhaI GCGC 2 cut(s) 32, 332
Hin1I GRCGYC 2 cut(s) 30, 96
Hin1II CATG 8 cut(s) 76, 243, 256, 370, 479, 485, 495, 546
Hin6I GCGC 2 cut(s) 30, 330
HinP1I GCGC 2 cut(s) 30, 330
HinfI GANTC 2 cut(s) 46, 65
HpaII CCGG 1 cut(s) 138
HphI GGTGA 1 cut(s) 52
Hpy166II GTNNAC 3 cut(s) 150, 287, 310
Hpy188I TCNGA 1 cut(s) 342
Hpy188III TCNNGA 2 cut(s) 401, 476
Hpy8I GTNNAC 3 cut(s) 150, 287, 310
Hpy99I CGWCG 2 cut(s) 98, 350
HpyCH4V TGCA 2 cut(s) 72, 468
HpyF10VI GCNNNNNNNGC 2 cut(s) 78, 329
HpyF3I CTNAG 2 cut(s) 291, 422
Hsp92I GRCGYC 2 cut(s) 30, 96
Hsp92II CATG 8 cut(s) 76, 243, 256, 370, 479, 485, 495, 546
HspAI GCGC 2 cut(s) 30, 330
KasI GGCGCC 1 cut(s) 29
KpnI GGTACC 1 cut(s) 413
Kzo9I GATC 2 cut(s) 342, 517
LmnI GCTCC 1 cut(s) 539
LpnPI CCDG 5 cut(s) 73, 82, 151, 234, 378
LweI GCATC 1 cut(s) 455
MalI GATC 2 cut(s) 344, 519
MboI GATC 2 cut(s) 342, 517
MboII GAAGA 2 cut(s) 55, 169
MhlI GDGCHC 1 cut(s) 475
MluCI AATT 3 cut(s) 10, 222, 353
Mly113I GGCGCC 1 cut(s) 30
MmeI TCCRAC 2 cut(s) 364, 433
MnlI CCTC 4 cut(s) 71, 109, 213, 530
MseI TTAA 2 cut(s) 84, 431
MslI CAYNNNNRTG 4 cut(s) 38, 195, 197, 480
MspI CCGG 1 cut(s) 138
MvnI CGCG 1 cut(s) 507
MwoI GCNNNNNNNGC 2 cut(s) 78, 329
NarI GGCGCC 1 cut(s) 30
NdeII GATC 2 cut(s) 342, 517
NlaIII CATG 8 cut(s) 76, 243, 256, 370, 479, 485, 495, 546
NlaIV GGNNCC 2 cut(s) 31, 411
NspI RCATGY 2 cut(s) 76, 243
OliI CACNNNNGTG 1 cut(s) 197
PaeI GCATGC 1 cut(s) 76
PagI TCATGA 1 cut(s) 475
PciI ACATGT 1 cut(s) 239
PfeI GAWTC 2 cut(s) 46, 65
PkrI GCNGC 2 cut(s) 498, 506
PluTI GGCGCC 1 cut(s) 33
PpuMI RGGWCCY 1 cut(s) 230
PscI ACATGT 1 cut(s) 239
Psp5II RGGWCCY 1 cut(s) 230
PspN4I GGNNCC 2 cut(s) 31, 411
PspPI GGNCC 1 cut(s) 230
PspPPI RGGWCCY 1 cut(s) 230
RsaI GTAC 4 cut(s) 149, 238, 311, 411
RsaNI GTAC 4 cut(s) 148, 237, 310, 410
RseI CAYNNNNRTG 4 cut(s) 38, 195, 197, 480
SaqAI TTAA 2 cut(s) 84, 431
SatI GCNGC 2 cut(s) 497, 505
Sau3AI GATC 2 cut(s) 342, 517
Sau96I GGNCC 1 cut(s) 230
SduI GDGCHC 1 cut(s) 475
SetI ASST 4 cut(s) 118, 232, 292, 411
SfaNI GCATC 1 cut(s) 455
SfoI GGCGCC 1 cut(s) 31
SinI GGWCC 1 cut(s) 230
SmiMI CAYNNNNRTG 4 cut(s) 38, 195, 197, 480
SphI GCATGC 1 cut(s) 76
Sse9I AATT 3 cut(s) 10, 222, 353
SsiI CCGC 4 cut(s) 321, 497, 505, 511
SspDI GGCGCC 1 cut(s) 29
StyI CCWWGG 1 cut(s) 112
TaqI TCGA 2 cut(s) 463, 535
TasI AATT 3 cut(s) 10, 222, 353
TatI WGTACW 3 cut(s) 147, 236, 309
TauI GCSGC 2 cut(s) 499, 507
TfiI GAWTC 2 cut(s) 46, 65
Tru1I TTAA 2 cut(s) 84, 431
Tru9I TTAA 2 cut(s) 84, 431
TscAI CASTG 2 cut(s) 112, 475
TspDTI ATGAA 3 cut(s) 33, 480, 492
TspGWI ACGGA 1 cut(s) 182
TspRI CASTG 2 cut(s) 112, 475
VpaK11BI GGWCC 1 cut(s) 230
XagI CCTNNNNNAGG 1 cut(s) 294
XapI RAATTY 1 cut(s) 222
XceI RCATGY 2 cut(s) 76, 243
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.