pycom15g18630

ribonuclease H protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
N/A
Physical Location & Seq
Forward (+)
13241519 .. 13241728
210 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 210 bp
ATGGCGGAGGCTGAGGCGATTAGGCAAGGGATGGAGATGATTATTGCTAGTGATGTTATGAAACCTGGGATTAGGTTGGCTATGGAATCAGACTCAAAAGGGTTGATCCAAATGATTAACAAGGAGGATGGCGAGCTTGTTCCAATTGGTGAAGTTTTGCCTTACCCTTCACAATCGTGCAACTCACTTGGTGGCGACACAAGTAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

70

Amino Acids

7.34

Weight (kDa)

4.25

Isoelectric Point (pI)

46.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 5
AclWI GGATC 1 cut(s) 100
AdeI CACNNNGTG 1 cut(s) 191
AjnI CCWGG 1 cut(s) 64
AleI CACNNNNGTG 1 cut(s) 175
AluBI AGCT 1 cut(s) 136
AluI AGCT 1 cut(s) 136
AlwI GGATC 1 cut(s) 100
AsuHPI GGTGA 1 cut(s) 161
BbvCI CCTCAGC 1 cut(s) 12
BccI CCATC 2 cut(s) 25, 122
BciT130I CCWGG 1 cut(s) 66
BfaI CTAG 1 cut(s) 48
Bme1390I CCNGG 1 cut(s) 66
BmrFI CCNGG 1 cut(s) 66
Bpu10I CCTNAGC 1 cut(s) 12
BsaJI CCNNGG 1 cut(s) 65
BseBI CCWGG 1 cut(s) 66
BseDI CCNNGG 1 cut(s) 65
BseGI GGATG 2 cut(s) 36, 133
Bsp143I GATC 1 cut(s) 105
BspACI CCGC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 4
BspPI GGATC 1 cut(s) 100
BssECI CCNNGG 1 cut(s) 65
BssMI GATC 1 cut(s) 105
Bst2UI CCWGG 1 cut(s) 66
BstC8I GCNNGC 1 cut(s) 134
BstDEI CTNAG 1 cut(s) 12
BstF5I GGATG 2 cut(s) 36, 133
BstKTI GATC 1 cut(s) 108
BstMBI GATC 1 cut(s) 105
BstNI CCWGG 1 cut(s) 66
BstSCI CCNGG 1 cut(s) 64
BtsCI GGATG 2 cut(s) 36, 133
Cac8I GCNNGC 1 cut(s) 134
CviJI RGCY 3 cut(s) 11, 80, 136
CviKI_1 RGCY 3 cut(s) 11, 80, 136
DdeI CTNAG 1 cut(s) 12
DpnI GATC 1 cut(s) 107
DpnII GATC 1 cut(s) 105
DraIII CACNNNGTG 1 cut(s) 191
EciI GGCGGA 1 cut(s) 20
EcoRII CCWGG 1 cut(s) 64
FaiI YATR 2 cut(s) 59, 83
FokI GGATG 2 cut(s) 43, 140
FspBI CTAG 1 cut(s) 48
HinfI GANTC 2 cut(s) 86, 92
HphI GGTGA 1 cut(s) 161
Hpy188I TCNGA 1 cut(s) 91
HpyAV CCTTC 1 cut(s) 177
HpyCH4V TGCA 1 cut(s) 180
HpyF3I CTNAG 1 cut(s) 12
Kzo9I GATC 1 cut(s) 105
LpnPI CCDG 2 cut(s) 51, 78
MaeI CTAG 1 cut(s) 48
MalI GATC 1 cut(s) 107
MboI GATC 1 cut(s) 105
MfeI CAATTG 1 cut(s) 144
MluCI AATT 1 cut(s) 144
MlyI GAGTC 1 cut(s) 86
MnlI CCTC 2 cut(s) 7, 118
MseI TTAA 2 cut(s) 117, 208
MslI CAYNNNNRTG 1 cut(s) 175
MspR9I CCNGG 1 cut(s) 66
MunI CAATTG 1 cut(s) 144
MvaI CCWGG 1 cut(s) 66
NdeII GATC 1 cut(s) 105
OliI CACNNNNGTG 1 cut(s) 175
PfeI GAWTC 1 cut(s) 86
PleI GAGTC 1 cut(s) 86
PpsI GAGTC 1 cut(s) 86
Psp6I CCWGG 1 cut(s) 64
PspGI CCWGG 1 cut(s) 64
RseI CAYNNNNRTG 1 cut(s) 175
SaqAI TTAA 2 cut(s) 117, 208
Sau3AI GATC 1 cut(s) 105
SchI GAGTC 1 cut(s) 86
ScrFI CCNGG 1 cut(s) 66
SetI ASST 3 cut(s) 67, 77, 138
SgeI CNNG 9 cut(s) 38, 60, 77, 78, 133, 145, 149, 189, 200
SmiMI CAYNNNNRTG 1 cut(s) 175
Sse9I AATT 1 cut(s) 144
SsiI CCGC 1 cut(s) 5
SspMI CTAG 1 cut(s) 48
StyD4I CCNGG 1 cut(s) 64
TasI AATT 1 cut(s) 144
TfiI GAWTC 1 cut(s) 86
Tru1I TTAA 2 cut(s) 117, 208
Tru9I TTAA 2 cut(s) 117, 208
TspDTI ATGAA 1 cut(s) 74
XspI CTAG 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.