pycom15g25020

Ribosomal protein L13

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
N/A
Physical Location & Seq
Forward (+)
19367693 .. 19371243
3551 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 213 bp
ATGAATGCCCGCCAATTGTTTGTGGAATGTCCTGAGAGAGACCTTGTGTTTAATGGAATTTGTGCTTTGATGTTCATACAGAAAGCTCGTACTGGCCTGAGACGTATTGATCTTGACGGTCTGCGGAGGAAAGTTTTCGATGCGAAAGGCCAGGTAAATAAGGTTGGAGATTGGGTATTCTTAAAGTTCTTGTCGTGGAAATATGTTGTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

8.22

Weight (kDa)

9.92

Isoelectric Point (pI)

38.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 10, 124
AcsI RAATTY 1 cut(s) 57
AfaI GTAC 1 cut(s) 91
AjnI CCWGG 1 cut(s) 150
AluBI AGCT 1 cut(s) 86
AluI AGCT 1 cut(s) 86
Alw26I GTCTC 2 cut(s) 33, 94
AoxI GGCC 2 cut(s) 94, 148
ApoI RAATTY 1 cut(s) 57
Asp700I GAANNNNTTC 1 cut(s) 134
BciT130I CCWGG 1 cut(s) 152
BcoDI GTCTC 2 cut(s) 33, 94
Bme1390I CCNGG 1 cut(s) 152
BmrFI CCNGG 1 cut(s) 152
BmsI GCATC 1 cut(s) 130
BsaI GGTCTC 1 cut(s) 33
BsaXI ACNNNNNCTCC 2 cut(s) 159, 189
Bse1I ACTGG 1 cut(s) 97
BseBI CCWGG 1 cut(s) 152
BseMII CTCAG 2 cut(s) 24, 89
BseNI ACTGG 1 cut(s) 97
BshFI GGCC 2 cut(s) 96, 150
BsmAI GTCTC 2 cut(s) 33, 94
BsmBI CGTCTC 1 cut(s) 94
BsmI GAATGC 1 cut(s) 10
BsnI GGCC 2 cut(s) 96, 150
Bso31I GGTCTC 1 cut(s) 33
Bsp143I GATC 1 cut(s) 109
BspACI CCGC 2 cut(s) 10, 124
BspANI GGCC 2 cut(s) 96, 150
BspCNI CTCAG 2 cut(s) 25, 90
BspTNI GGTCTC 1 cut(s) 33
BsrI ACTGG 1 cut(s) 97
BssMI GATC 1 cut(s) 109
Bst2UI CCWGG 1 cut(s) 152
Bst4CI ACNGT 1 cut(s) 119
BstC8I GCNNGC 1 cut(s) 10
BstDEI CTNAG 2 cut(s) 33, 98
BstKTI GATC 1 cut(s) 112
BstMAI GTCTC 2 cut(s) 33, 94
BstMBI GATC 1 cut(s) 109
BstNI CCWGG 1 cut(s) 152
BstSCI CCNGG 1 cut(s) 150
BsuRI GGCC 2 cut(s) 96, 150
Cac8I GCNNGC 1 cut(s) 10
Csp6I GTAC 1 cut(s) 90
CviJI RGCY 3 cut(s) 86, 96, 150
CviKI_1 RGCY 3 cut(s) 86, 96, 150
CviQI GTAC 1 cut(s) 90
DdeI CTNAG 2 cut(s) 33, 98
DpnI GATC 1 cut(s) 111
DpnII GATC 1 cut(s) 109
Eco31I GGTCTC 1 cut(s) 33
EcoRII CCWGG 1 cut(s) 150
Esp3I CGTCTC 1 cut(s) 94
FaiI YATR 3 cut(s) 77, 204, 211
FauI CCCGC 1 cut(s) 17
HaeIII GGCC 2 cut(s) 96, 150
Hpy188III TCNNGA 2 cut(s) 32, 113
HpyCH4III ACNGT 1 cut(s) 119
HpyCH4IV ACGT 1 cut(s) 103
HpyF3I CTNAG 2 cut(s) 33, 98
HpySE526I ACGT 1 cut(s) 103
Kzo9I GATC 1 cut(s) 109
LpnPI CCDG 5 cut(s) 45, 78, 110, 137, 164
LweI GCATC 1 cut(s) 130
MaeII ACGT 1 cut(s) 103
MalI GATC 1 cut(s) 111
MboI GATC 1 cut(s) 109
MfeI CAATTG 1 cut(s) 14
MluCI AATT 2 cut(s) 14, 57
MmeI TCCRAC 1 cut(s) 145
MnlI CCTC 1 cut(s) 120
MroXI GAANNNNTTC 1 cut(s) 134
MseI TTAA 2 cut(s) 51, 182
MspR9I CCNGG 1 cut(s) 152
MunI CAATTG 1 cut(s) 14
Mva1269I GAATGC 1 cut(s) 10
MvaI CCWGG 1 cut(s) 152
NdeII GATC 1 cut(s) 109
PctI GAATGC 1 cut(s) 10
PdmI GAANNNNTTC 1 cut(s) 134
Psp6I CCWGG 1 cut(s) 150
PspGI CCWGG 1 cut(s) 150
RsaI GTAC 1 cut(s) 91
RsaNI GTAC 1 cut(s) 90
SaqAI TTAA 2 cut(s) 51, 182
Sau3AI GATC 1 cut(s) 109
ScrFI CCNGG 1 cut(s) 152
SetI ASST 5 cut(s) 45, 88, 106, 156, 165
SfaNI GCATC 1 cut(s) 130
Sse9I AATT 2 cut(s) 14, 57
SsiI CCGC 2 cut(s) 10, 124
StyD4I CCNGG 1 cut(s) 150
TaaI ACNGT 1 cut(s) 119
TaiI ACGT 1 cut(s) 106
TaqI TCGA 1 cut(s) 138
TasI AATT 2 cut(s) 14, 57
Tru1I TTAA 2 cut(s) 51, 182
Tru9I TTAA 2 cut(s) 51, 182
TspDTI ATGAA 2 cut(s) 17, 64
XapI RAATTY 1 cut(s) 57
XmnI GAANNNNTTC 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.