pycom15g26410

DEAD-box ATP-dependent RNA helicase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
N/A
Physical Location & Seq
Forward (+)
21297167 .. 21297540
374 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 207 bp
ATGATCGATCTTCTGTTGTCATATGGTTATGAGGCAGATATAAAAGCATTTACACCTGACATCCCTAAGCATTGTCAATGTCTTCTTATGTCAGCCACCGCAAAGTTTGTTATTTATAGAATAACTGCACCAGTCTTATTTTTAGAATTCAGAAAATTAAGAGTTGATGTTAAGGATGATGTATTTGGTGTCATTGTTTATCTTTAG

Protein Analysis

69

Amino Acids

7.83

Weight (kDa)

6.52

Isoelectric Point (pI)

9.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 99
AcsI RAATTY 1 cut(s) 146
ApoI RAATTY 1 cut(s) 146
BbsI GAAGAC 1 cut(s) 74
BpiI GAAGAC 1 cut(s) 74
Bpu10I CCTNAGC 1 cut(s) 66
Bsa29I ATCGAT 1 cut(s) 6
Bse1I ACTGG 1 cut(s) 131
BseCI ATCGAT 1 cut(s) 6
BseGI GGATG 2 cut(s) 60, 181
BseNI ACTGG 1 cut(s) 131
BsgI GTGCAG 1 cut(s) 111
BshVI ATCGAT 1 cut(s) 6
Bsp143I GATC 2 cut(s) 3, 7
BspACI CCGC 1 cut(s) 99
BspDI ATCGAT 1 cut(s) 6
BsrI ACTGG 1 cut(s) 131
BssMI GATC 2 cut(s) 3, 7
BstDEI CTNAG 1 cut(s) 66
BstF5I GGATG 2 cut(s) 60, 181
BstKTI GATC 2 cut(s) 6, 10
BstMBI GATC 2 cut(s) 3, 7
BstV2I GAAGAC 1 cut(s) 74
Bsu15I ATCGAT 1 cut(s) 6
BsuTUI ATCGAT 1 cut(s) 6
BtsCI GGATG 2 cut(s) 60, 181
ClaI ATCGAT 1 cut(s) 6
CviJI RGCY 1 cut(s) 95
CviKI_1 RGCY 1 cut(s) 95
DdeI CTNAG 1 cut(s) 66
DpnI GATC 2 cut(s) 5, 9
DpnII GATC 2 cut(s) 3, 7
EcoRI GAATTC 1 cut(s) 146
FaiI YATR 6 cut(s) 22, 24, 30, 41, 89, 117
FauNDI CATATG 1 cut(s) 22
FokI GGATG 2 cut(s) 47, 188
Hpy188I TCNGA 1 cut(s) 152
HpyCH4V TGCA 1 cut(s) 128
HpyF3I CTNAG 1 cut(s) 66
Kzo9I GATC 2 cut(s) 3, 7
LpnPI CCDG 2 cut(s) 69, 144
MalI GATC 2 cut(s) 5, 9
MboI GATC 2 cut(s) 3, 7
MboII GAAGA 1 cut(s) 74
MluCI AATT 2 cut(s) 146, 155
MnlI CCTC 1 cut(s) 25
MseI TTAA 2 cut(s) 158, 171
NdeI CATATG 1 cut(s) 22
NdeII GATC 2 cut(s) 3, 7
SaqAI TTAA 2 cut(s) 158, 171
Sau3AI GATC 2 cut(s) 3, 7
SetI ASST 1 cut(s) 58
SgeI CNNG 2 cut(s) 68, 143
Sse9I AATT 2 cut(s) 146, 155
SsiI CCGC 1 cut(s) 99
TaqI TCGA 1 cut(s) 6
TasI AATT 2 cut(s) 146, 155
Tru1I TTAA 2 cut(s) 158, 171
Tru9I TTAA 2 cut(s) 158, 171
XapI RAATTY 1 cut(s) 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.