pycom15g27330

This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the transport of calcium

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
N/A
Physical Location & Seq
Reverse (-)
22648921 .. 22649220
300 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 300 bp
ATGAAAAGGCATAATTTGGTAGAAGTTACCCTTGCTTTACTATTAGAGTTTGGCTATCTTGATAAAATATTCATTAATCATATTTTCCAACTAGAATCATTTCCTGAAAAGCTTATGAAAGTAGCAAAAGATTATCAGGAAAAATGGAACGAAATTTGCATAAGTTTTATTAGTAGTCATCCAGATTGGTATGTACATATGAATAAGGAGAAAGCTAGACATATAGCCATGATTAATGAAGAGTTCTTTAGACCATCCCCTATCTCTTCACATGGACTCCTTCATACAACAATATTCTAA

Protein Analysis

100

Amino Acids

11.83

Weight (kDa)

6.64

Isoelectric Point (pI)

49.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 153
AfaI GTAC 1 cut(s) 195
AluBI AGCT 2 cut(s) 112, 215
AluI AGCT 2 cut(s) 112, 215
ApoI RAATTY 1 cut(s) 153
AseI ATTAAT 2 cut(s) 75, 234
Asp700I GAANNNNTTC 1 cut(s) 99
BccI CCATC 1 cut(s) 262
BfaI CTAG 2 cut(s) 92, 216
BsaXI ACNNNNNCTCC 2 cut(s) 261, 291
BseGI GGATG 2 cut(s) 178, 254
Bsp1407I TGTACA 1 cut(s) 193
BsrGI TGTACA 1 cut(s) 193
Bst6I CTCTTC 2 cut(s) 234, 271
BstAUI TGTACA 1 cut(s) 193
BstF5I GGATG 2 cut(s) 178, 254
BtsCI GGATG 2 cut(s) 178, 254
Csp6I GTAC 1 cut(s) 194
CviAII CATG 2 cut(s) 229, 272
CviJI RGCY 4 cut(s) 54, 112, 215, 227
CviKI_1 RGCY 4 cut(s) 54, 112, 215, 227
CviQI GTAC 1 cut(s) 194
Eam1104I CTCTTC 2 cut(s) 234, 271
EarI CTCTTC 2 cut(s) 234, 271
FaeI CATG 2 cut(s) 232, 275
FalI AAGNNNNNCTT 2 cut(s) 15, 47
FatI CATG 2 cut(s) 228, 271
FauNDI CATATG 1 cut(s) 198
FokI GGATG 2 cut(s) 165, 241
FspBI CTAG 2 cut(s) 92, 216
Hin1II CATG 2 cut(s) 232, 275
HindIII AAGCTT 1 cut(s) 110
HinfI GANTC 2 cut(s) 95, 276
Hpy188III TCNNGA 4 cut(s) 59, 104, 137, 182
HpyAV CCTTC 1 cut(s) 290
HpyCH4V TGCA 1 cut(s) 159
Hsp92II CATG 2 cut(s) 232, 275
LpnPI CCDG 3 cut(s) 117, 122, 195
MaeI CTAG 2 cut(s) 92, 216
MaeIII GTNAC 1 cut(s) 25
MboII GAAGA 2 cut(s) 251, 258
MluCI AATT 2 cut(s) 13, 153
MlyI GAGTC 1 cut(s) 270
MmeI TCCRAC 1 cut(s) 112
MroXI GAANNNNTTC 1 cut(s) 99
MseI TTAA 2 cut(s) 75, 234
NdeI CATATG 1 cut(s) 198
NlaIII CATG 2 cut(s) 232, 275
PdmI GAANNNNTTC 1 cut(s) 99
PfeI GAWTC 1 cut(s) 95
PleI GAGTC 1 cut(s) 270
PpsI GAGTC 1 cut(s) 270
PshBI ATTAAT 2 cut(s) 75, 234
RsaI GTAC 1 cut(s) 195
RsaNI GTAC 1 cut(s) 194
SaqAI TTAA 2 cut(s) 75, 234
SchI GAGTC 1 cut(s) 270
SetI ASST 2 cut(s) 114, 217
SgeI CNNG 9 cut(s) 44, 71, 104, 116, 149, 194, 228, 241, 284
Sse9I AATT 2 cut(s) 13, 153
SspI AATATT 2 cut(s) 69, 294
SspMI CTAG 2 cut(s) 92, 216
TasI AATT 2 cut(s) 13, 153
TatI WGTACW 1 cut(s) 193
TfiI GAWTC 1 cut(s) 95
Tru1I TTAA 2 cut(s) 75, 234
Tru9I TTAA 2 cut(s) 75, 234
TspDTI ATGAA 6 cut(s) 17, 61, 131, 215, 252, 272
VspI ATTAAT 2 cut(s) 75, 234
XapI RAATTY 1 cut(s) 153
XmnI GAANNNNTTC 1 cut(s) 99
XspI CTAG 2 cut(s) 92, 216
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.