pycom15g27640

Catalyzes the third of the four reactions of the long- chain fatty acids elongation cycle. This endoplasmic reticulum- bound enzymatic process, allows the addition of two carbons to the chain of long- and very long-chain fatty acids VLCFAs per cycle. This enzyme catalyzes the dehydration of the 3-hydroxyacyl-CoA intermediate into trans-2,3-enoyl-CoA, within each cycle of fatty acid elongation. Thereby, it participates to the production of VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
N/A
Physical Location & Seq
Forward (+)
23107414 .. 23108569
1156 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 300 bp
ATGCTAGTGTGCTCTTTGGTCATCAGCTGGTCTATCACCGAGATTATTCGATACTCTTTCTTTGGCATGAAGGAGGCTCTTGGTTTTGCACCTTCATGGCTCTTGTGGCTCAGCTTGTTGTATCCAACTGACATCAAAAGTGAAGTTGGTCTAATATATATTGCCCTGCCACACATGAATGGGGTGGTTTCCTGGGTTTTGAGAGTTAGGTGTGGCGTAGTGTCGTTTATTACTCATCTAGTACAGGGAACTTTGCATATCATCTTCTGCTTATCCACTGCAGCTACAAAGAGCGTGTAG

Protein Analysis

100

Amino Acids

11.06

Weight (kDa)

8.57

Isoelectric Point (pI)

30.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PTPLA PF04387 2 - 80 3.5e-12 Protein tyrosine phosphatase-like protein, PTPLA
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 243
AjnI CCWGG 1 cut(s) 191
AluBI AGCT 3 cut(s) 27, 114, 284
AluI AGCT 3 cut(s) 27, 114, 284
Alw21I GWGCWC 1 cut(s) 14
ApeKI GCWGC 1 cut(s) 281
AsuHPI GGTGA 1 cut(s) 28
Bbv12I GWGCWC 1 cut(s) 14
BbvI GCAGC 1 cut(s) 293
BciT130I CCWGG 1 cut(s) 193
BciVI GTATCC 1 cut(s) 132
BfaI CTAG 2 cut(s) 5, 239
BfmI CTRYAG 1 cut(s) 279
BfuI GTATCC 1 cut(s) 132
BisI GCNGC 1 cut(s) 282
BlpI GCTNAGC 1 cut(s) 110
BlsI GCNGC 1 cut(s) 283
Bme1390I CCNGG 1 cut(s) 193
BmrFI CCNGG 1 cut(s) 193
Bpu1102I GCTNAGC 1 cut(s) 110
BsaJI CCNNGG 1 cut(s) 192
BseBI CCWGG 1 cut(s) 193
BseDI CCNNGG 1 cut(s) 192
BseMII CTCAG 1 cut(s) 124
BseXI GCAGC 1 cut(s) 293
BsiHKAI GWGCWC 1 cut(s) 14
Bsp1286I GDGCHC 1 cut(s) 14
Bsp1720I GCTNAGC 1 cut(s) 110
BspCNI CTCAG 1 cut(s) 123
BspMAI CTGCAG 1 cut(s) 283
BssECI CCNNGG 1 cut(s) 192
Bst2UI CCWGG 1 cut(s) 193
BstDEI CTNAG 1 cut(s) 110
BstMWI GCNNNNNNNGC 1 cut(s) 106
BstNI CCWGG 1 cut(s) 193
BstSCI CCNGG 1 cut(s) 191
BstSFI CTRYAG 1 cut(s) 279
BstV1I GCAGC 1 cut(s) 293
BsuI GTATCC 1 cut(s) 132
BtsI GCAGTG 1 cut(s) 276
BtsIMutI CAGTG 1 cut(s) 276
Csp6I GTAC 1 cut(s) 242
CviAII CATG 3 cut(s) 67, 96, 175
CviJI RGCY 6 cut(s) 27, 77, 100, 109, 114, 284
CviKI_1 RGCY 6 cut(s) 27, 77, 100, 109, 114, 284
CviQI GTAC 1 cut(s) 242
DdeI CTNAG 1 cut(s) 110
EcoRII CCWGG 1 cut(s) 191
FaeI CATG 3 cut(s) 70, 99, 178
FaiI YATR 6 cut(s) 68, 97, 157, 159, 176, 258
FatI CATG 3 cut(s) 66, 95, 174
Fnu4HI GCNGC 1 cut(s) 282
Fsp4HI GCNGC 1 cut(s) 282
FspBI CTAG 2 cut(s) 5, 239
GluI GCNGC 1 cut(s) 282
Hin1II CATG 3 cut(s) 70, 99, 178
HphI GGTGA 1 cut(s) 28
HpyAV CCTTC 2 cut(s) 64, 102
HpyCH4V TGCA 3 cut(s) 89, 256, 281
HpyF10VI GCNNNNNNNGC 1 cut(s) 106
HpyF3I CTNAG 1 cut(s) 110
Hsp92II CATG 3 cut(s) 70, 99, 178
LpnPI CCDG 5 cut(s) 13, 178, 179, 205, 230
Lsp1109I GCAGC 1 cut(s) 293
MaeI CTAG 2 cut(s) 5, 239
MboII GAAGA 1 cut(s) 256
MhlI GDGCHC 1 cut(s) 14
MmeI TCCRAC 1 cut(s) 149
MnlI CCTC 1 cut(s) 67
MslI CAYNNNNRTG 2 cut(s) 94, 177
MspA1I CMGCKG 1 cut(s) 27
MspR9I CCNGG 1 cut(s) 193
MvaI CCWGG 1 cut(s) 193
MwoI GCNNNNNNNGC 1 cut(s) 106
NlaIII CATG 3 cut(s) 70, 99, 178
PkrI GCNGC 1 cut(s) 283
Psp6I CCWGG 1 cut(s) 191
PspGI CCWGG 1 cut(s) 191
PstI CTGCAG 1 cut(s) 283
PvuII CAGCTG 1 cut(s) 27
RsaI GTAC 1 cut(s) 243
RsaNI GTAC 1 cut(s) 242
RseI CAYNNNNRTG 2 cut(s) 94, 177
SatI GCNGC 1 cut(s) 282
ScrFI CCNGG 1 cut(s) 193
SduI GDGCHC 1 cut(s) 14
SetI ASST 5 cut(s) 29, 94, 116, 212, 286
SfcI CTRYAG 1 cut(s) 279
SmiMI CAYNNNNRTG 2 cut(s) 94, 177
SspMI CTAG 2 cut(s) 5, 239
StyD4I CCNGG 1 cut(s) 191
TaqI TCGA 1 cut(s) 49
TatI WGTACW 1 cut(s) 241
TscAI CASTG 1 cut(s) 283
TseI GCWGC 1 cut(s) 281
TspDTI ATGAA 3 cut(s) 83, 84, 191
TspRI CASTG 1 cut(s) 283
XspI CTAG 2 cut(s) 5, 239
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.