Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr15

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Reverse (-)

26676271 .. 26676654

Gene Structure 384 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 288 bp

ATGGCCATTACTGTGATCATCTCACTGCAGTTTTTGACAAAGCTCTTGTATTACACACTAACAGCAATCCTTGCTTCAATTATTCTCTCTGCACTGCCCGGACTTATTAACCTGAGTGAAGTCTACAAAATTTGGAAGGTTGATAGGCTAGATTTCTTGGCTTGCATTGGAGCCTTCTTTGGGGTCCTATTTGCGTCCGTGGAGATTGGCCTTCTAGTTGCGGACCCTTTTAATTATTATTTTTTGGGTCAGCTAATAGAACACATTTTAATTAATCACAACTCTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005215 GO:0005575 GO:0005623 GO:0005886 GO:0005887 GO:0006810 GO:0006811 GO:0006820 GO:0008150 GO:0008272 GO:0008509 GO:0015075 GO:0015103 GO:0015116 GO:0015318 GO:0015698 GO:0016020 GO:0016021 GO:0022857 GO:0031224 GO:0031226 GO:0034220 GO:0044425 GO:0044459 GO:0044464 GO:0051179 GO:0051234 GO:0055085 GO:0071944 GO:0072348 GO:0098656 GO:0098660 GO:0098661 GO:1901682 GO:1902358

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

STAS Sulfate_transp

Protein Analysis

96

Amino Acids

10.62

Weight (kDa)

5.4

Isoelectric Point (pI)

36.87

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Sulfate_transp	PF00916	1 - 56	2.5e-11	Sulfate permease family

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	123
AciI	CCGC	1 cut(s)	221
AcoI	YGGCCR	1 cut(s)	3
AcsI	RAATTY	1 cut(s)	129
AfiI	CCNNNNNNNGG	1 cut(s)	180
AgsI	TTSAA	1 cut(s)	78
AluBI	AGCT	2 cut(s)	43, 253
AluI	AGCT	2 cut(s)	43, 253
AoxI	GGCC	2 cut(s)	3, 208
ApoI	RAATTY	1 cut(s)	129
AseI	ATTAAT	1 cut(s)	273
AspS9I	GGNCC	2 cut(s)	184, 223
AsuC2I	CCSGG	1 cut(s)	99
AvaII	GGWCC	2 cut(s)	184, 223
BalI	TGGCCA	1 cut(s)	5
BclI	TGATCA	1 cut(s)	15
BcnI	CCSGG	1 cut(s)	99
BfaI	CTAG	2 cut(s)	149, 215
BfmI	CTRYAG	1 cut(s)	26
Bme1390I	CCNGG	1 cut(s)	99
Bme18I	GGWCC	2 cut(s)	184, 223
BmgT120I	GGNCC	2 cut(s)	184, 223
BmiI	GGNNCC	3 cut(s)	172, 185, 225
BmrFI	CCNGG	1 cut(s)	99
BpuMI	CCSGG	1 cut(s)	99
BsaJI	CCNNGG	1 cut(s)	198
Bsc4I	CCNNNNNNNGG	1 cut(s)	180
BseDI	CCNNGG	1 cut(s)	198
BseLI	CCNNNNNNNGG	1 cut(s)	180
BseMII	CTCAG	1 cut(s)	104
BsgI	GTGCAG	1 cut(s)	75
BshFI	GGCC	2 cut(s)	5, 210
BsiSI	CCGG	1 cut(s)	99
BslI	CCNNNNNNNGG	1 cut(s)	180
BsnI	GGCC	2 cut(s)	5, 210
Bsp143I	GATC	1 cut(s)	15
BspACI	CCGC	1 cut(s)	221
BspANI	GGCC	2 cut(s)	5, 210
BspCNI	CTCAG	1 cut(s)	105
BspLI	GGNNCC	3 cut(s)	172, 185, 225
BspMAI	CTGCAG	1 cut(s)	30
BssECI	CCNNGG	1 cut(s)	198
BssMI	GATC	1 cut(s)	15
Bst4CI	ACNGT	1 cut(s)	13
BstAPI	GCANNNNNTGC	1 cut(s)	71
BstC8I	GCNNGC	1 cut(s)	163
BstDEI	CTNAG	2 cut(s)	113, 285
BstDSI	CCRYGG	1 cut(s)	198
BstKTI	GATC	1 cut(s)	18
BstMBI	GATC	1 cut(s)	15
BstMWI	GCNNNNNNNGC	1 cut(s)	71
BstSCI	CCNGG	1 cut(s)	97
BstSFI	CTRYAG	1 cut(s)	26
BsuRI	GGCC	2 cut(s)	5, 210
BtgI	CCRYGG	1 cut(s)	198
BtsI	GCAGTG	2 cut(s)	23, 92
BtsIMutI	CAGTG	2 cut(s)	23, 92
Cac8I	GCNNGC	1 cut(s)	163
Cfr13I	GGNCC	2 cut(s)	184, 223
CseI	GACGC	1 cut(s)	183
CviJI	RGCY	7 cut(s)	5, 43, 148, 161, 173, 210, 253
CviKI_1	RGCY	7 cut(s)	5, 43, 148, 161, 173, 210, 253
DdeI	CTNAG	2 cut(s)	113, 285
DpnI	GATC	1 cut(s)	17
DpnII	GATC	1 cut(s)	15
EaeI	YGGCCR	1 cut(s)	3
Eco47I	GGWCC	2 cut(s)	184, 223
EcoO109I	RGGNCCY	1 cut(s)	184
FbaI	TGATCA	1 cut(s)	15
FblI	GTMKAC	1 cut(s)	123
FspBI	CTAG	2 cut(s)	149, 215
HaeIII	GGCC	2 cut(s)	5, 210
HapII	CCGG	1 cut(s)	99
HgaI	GACGC	1 cut(s)	183
HpaII	CCGG	1 cut(s)	99
Hpy166II	GTNNAC	1 cut(s)	124
Hpy8I	GTNNAC	1 cut(s)	124
HpyAV	CCTTC	3 cut(s)	130, 184, 221
HpyCH4III	ACNGT	1 cut(s)	13
HpyCH4V	TGCA	3 cut(s)	28, 92, 165
HpyF10VI	GCNNNNNNNGC	1 cut(s)	71
HpyF3I	CTNAG	2 cut(s)	113, 285
Ksp22I	TGATCA	1 cut(s)	15
Kzo9I	GATC	1 cut(s)	15
LmnI	GCTCC	1 cut(s)	170
LpnPI	CCDG	2 cut(s)	112, 125
MaeI	CTAG	2 cut(s)	149, 215
MalI	GATC	1 cut(s)	17
MboI	GATC	1 cut(s)	15
MlsI	TGGCCA	1 cut(s)	5
MluCI	AATT	4 cut(s)	78, 129, 232, 270
MluNI	TGGCCA	1 cut(s)	5
Mox20I	TGGCCA	1 cut(s)	5
MscI	TGGCCA	1 cut(s)	5
MseI	TTAA	4 cut(s)	108, 231, 269, 273
MslI	CAYNNNNRTG	1 cut(s)	11
Msp20I	TGGCCA	1 cut(s)	5
MspI	CCGG	1 cut(s)	99
MspR9I	CCNGG	1 cut(s)	99
MwoI	GCNNNNNNNGC	1 cut(s)	71
NciI	CCSGG	1 cut(s)	99
NdeII	GATC	1 cut(s)	15
NlaIV	GGNNCC	3 cut(s)	172, 185, 225
PacI	TTAATTAA	1 cut(s)	273
PpuMI	RGGWCCY	1 cut(s)	184
PshBI	ATTAAT	1 cut(s)	273
Psp5II	RGGWCCY	1 cut(s)	184
PspN4I	GGNNCC	3 cut(s)	172, 185, 225
PspPI	GGNCC	2 cut(s)	184, 223
PspPPI	RGGWCCY	1 cut(s)	184
PstI	CTGCAG	1 cut(s)	30
RseI	CAYNNNNRTG	1 cut(s)	11
SaqAI	TTAA	4 cut(s)	108, 231, 269, 273
Sau3AI	GATC	1 cut(s)	15
Sau96I	GGNCC	2 cut(s)	184, 223
ScrFI	CCNGG	1 cut(s)	99
SetI	ASST	4 cut(s)	45, 114, 141, 255
SfcI	CTRYAG	1 cut(s)	26
SinI	GGWCC	2 cut(s)	184, 223
SmiMI	CAYNNNNRTG	1 cut(s)	11
Sse9I	AATT	4 cut(s)	78, 129, 232, 270
SsiI	CCGC	1 cut(s)	221
SspMI	CTAG	2 cut(s)	149, 215
StyD4I	CCNGG	1 cut(s)	97
TaaI	ACNGT	1 cut(s)	13
TasI	AATT	4 cut(s)	78, 129, 232, 270
Tru1I	TTAA	4 cut(s)	108, 231, 269, 273
Tru9I	TTAA	4 cut(s)	108, 231, 269, 273
TscAI	CASTG	2 cut(s)	30, 99
TspGWI	ACGGA	1 cut(s)	187
TspRI	CASTG	2 cut(s)	30, 99
VpaK11BI	GGWCC	2 cut(s)	184, 223
VspI	ATTAAT	1 cut(s)	273
XapI	RAATTY	1 cut(s)	129
XmiI	GTMKAC	1 cut(s)	123
XspI	CTAG	2 cut(s)	149, 215

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.