pycom15g30360

Chromatin assembly factor 1 subunit

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
N/A
Physical Location & Seq
Reverse (-)
27785950 .. 27786228
279 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 279 bp
ATGGACCCATTGGTCAACTACGTTGCTTCTCTTAGTTCTGATAAGACTTGTCGCATTTATGTCAAGAAACCTCAATCAAAAGGGACAAGTGCTGAGAAGGCAAATATGTTTCTCAGCATGCTATTTCGAAGGCTGAACATCCACTTTCGGATGATTCTAAGGTTGGCAGATAGTAAATTGTCTATTTATTTTGTTTATCATAATAATAGATGGAATAGACATGTTCTAAGCTTCTTGAGGTTTTCAACTGCAGTTTGCAAAAAACCATCTCTTTCTTGA

Protein Analysis

93

Amino Acids

10.79

Weight (kDa)

10.45

Isoelectric Point (pI)

46.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 11
AflIII ACRYGT 1 cut(s) 220
AgsI TTSAA 1 cut(s) 246
AluBI AGCT 1 cut(s) 231
AluI AGCT 1 cut(s) 231
AspS9I GGNCC 1 cut(s) 4
AsuII TTCGAA 1 cut(s) 127
AvaII GGWCC 1 cut(s) 4
BccI CCATC 2 cut(s) 204, 274
BfmI CTRYAG 1 cut(s) 249
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 1 cut(s) 6
Bpu14I TTCGAA 1 cut(s) 127
BpuEI CTTGAG 1 cut(s) 256
BseGI GGATG 2 cut(s) 138, 156
BseMII CTCAG 2 cut(s) 84, 127
BslFI GGGAC 1 cut(s) 97
BsmFI GGGAC 1 cut(s) 97
Bsp119I TTCGAA 1 cut(s) 127
BspCNI CTCAG 2 cut(s) 85, 126
BspLI GGNNCC 1 cut(s) 6
BspMAI CTGCAG 1 cut(s) 253
BspT104I TTCGAA 1 cut(s) 127
BstBI TTCGAA 1 cut(s) 127
BstC8I GCNNGC 1 cut(s) 119
BstDEI CTNAG 5 cut(s) 32, 93, 113, 158, 227
BstF5I GGATG 2 cut(s) 138, 156
BstMWI GCNNNNNNNGC 1 cut(s) 98
BstNSI RCATGY 2 cut(s) 121, 224
BstSFI CTRYAG 1 cut(s) 249
BtsCI GGATG 2 cut(s) 138, 156
Cac8I GCNNGC 1 cut(s) 119
Cfr13I GGNCC 1 cut(s) 4
CviAII CATG 2 cut(s) 118, 221
CviJI RGCY 2 cut(s) 133, 231
CviKI_1 RGCY 2 cut(s) 133, 231
DdeI CTNAG 5 cut(s) 32, 93, 113, 158, 227
DrdI GACNNNNNNGTC 1 cut(s) 11
DseDI GACNNNNNNGTC 1 cut(s) 11
Eco47I GGWCC 1 cut(s) 4
FaeI CATG 2 cut(s) 121, 224
FaiI YATR 5 cut(s) 60, 107, 119, 201, 222
FaqI GGGAC 1 cut(s) 97
FatI CATG 2 cut(s) 117, 220
FokI GGATG 2 cut(s) 125, 163
Hin1II CATG 2 cut(s) 121, 224
HincII GTYRAC 1 cut(s) 16
HindII GTYRAC 1 cut(s) 16
HindIII AAGCTT 1 cut(s) 229
HinfI GANTC 1 cut(s) 154
Hpy166II GTNNAC 1 cut(s) 16
Hpy188I TCNGA 2 cut(s) 40, 150
Hpy188III TCNNGA 3 cut(s) 64, 235, 276
Hpy8I GTNNAC 1 cut(s) 16
HpyAV CCTTC 2 cut(s) 91, 123
HpyCH4IV ACGT 1 cut(s) 21
HpyCH4V TGCA 2 cut(s) 251, 258
HpyF10VI GCNNNNNNNGC 1 cut(s) 98
HpyF3I CTNAG 5 cut(s) 32, 93, 113, 158, 227
HpySE526I ACGT 1 cut(s) 21
Hsp92II CATG 2 cut(s) 121, 224
MaeII ACGT 1 cut(s) 21
MluCI AATT 1 cut(s) 176
MnlI CCTC 2 cut(s) 81, 231
MwoI GCNNNNNNNGC 1 cut(s) 98
NlaIII CATG 2 cut(s) 121, 224
NlaIV GGNNCC 1 cut(s) 6
NspI RCATGY 2 cut(s) 121, 224
NspV TTCGAA 1 cut(s) 127
PaeI GCATGC 1 cut(s) 121
PciI ACATGT 1 cut(s) 220
PfeI GAWTC 1 cut(s) 154
PscI ACATGT 1 cut(s) 220
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 4
PstI CTGCAG 1 cut(s) 253
Sau96I GGNCC 1 cut(s) 4
SetI ASST 5 cut(s) 24, 73, 164, 233, 242
SfcI CTRYAG 1 cut(s) 249
SfuI TTCGAA 1 cut(s) 127
SgeI CNNG 6 cut(s) 60, 76, 99, 130, 233, 247
SinI GGWCC 1 cut(s) 4
SmlI CTYRAG 1 cut(s) 235
SmoI CTYRAG 1 cut(s) 235
SphI GCATGC 1 cut(s) 121
Sse9I AATT 1 cut(s) 176
TaiI ACGT 1 cut(s) 24
TaqI TCGA 1 cut(s) 127
TasI AATT 1 cut(s) 176
TfiI GAWTC 1 cut(s) 154
VpaK11BI GGWCC 1 cut(s) 4
XceI RCATGY 2 cut(s) 121, 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.