pycom15g31430

Histone chaperone domain CHZ

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
N/A
Physical Location & Seq
Forward (+)
29877736 .. 29879427
1692 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 306 bp
ATGGTGGTGGTTAAAATCAAGGAAGTCAAAAAGAAAAAGGAAAGGGCAAAAGAGCTCGAAGGCATTGACATGAGTAACATTGTAACGAGCTCACGTAGAAGGTCCACAACTAGTTTTGTGCCTCCTCCAAAGCCCAAAATACCAGTTGAAAGTGATTCTGATGATGGTGAAAGTTCAGATGATGACAATGATGAAGCTGACAACAGTGACAAGGAAGAGAATGAGGTTGAGGACAAGGACATTGAGGATAATGGTAATAGTGATGACAACCATAGTGATGAGGATGAAGCTGATGACAGTGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

11.28

Weight (kDa)

4.2

Isoelectric Point (pI)

55.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CHZ PF09649 14 - 46 4.8e-11 Histone chaperone domain CHZ
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 149
AhlI ACTAGT 1 cut(s) 110
AluBI AGCT 4 cut(s) 55, 90, 197, 290
AluI AGCT 4 cut(s) 55, 90, 197, 290
Alw21I GWGCWC 2 cut(s) 57, 92
AspS9I GGNCC 1 cut(s) 102
AsuHPI GGTGA 1 cut(s) 179
AvaII GGWCC 1 cut(s) 102
BanII GRGCYC 2 cut(s) 57, 92
Bbv12I GWGCWC 2 cut(s) 57, 92
BccI CCATC 1 cut(s) 158
BcuI ACTAGT 1 cut(s) 110
BfaI CTAG 1 cut(s) 111
Bme18I GGWCC 1 cut(s) 102
BmgT120I GGNCC 1 cut(s) 102
BsaAI YACGTR 1 cut(s) 95
Bse1I ACTGG 1 cut(s) 143
BseGI GGATG 1 cut(s) 289
BseNI ACTGG 1 cut(s) 143
BseRI GAGGAG 1 cut(s) 114
BsiHKAI GWGCWC 2 cut(s) 57, 92
Bsp1286I GDGCHC 2 cut(s) 57, 92
BsrI ACTGG 1 cut(s) 143
Bst4CI ACNGT 2 cut(s) 206, 299
Bst6I CTCTTC 1 cut(s) 210
BstBAI YACGTR 1 cut(s) 95
BstF5I GGATG 1 cut(s) 289
BtsCI GGATG 1 cut(s) 289
BtsIMutI CAGTG 2 cut(s) 211, 304
Cfr13I GGNCC 1 cut(s) 102
CviAII CATG 1 cut(s) 70
CviJI RGCY 5 cut(s) 55, 90, 133, 197, 290
CviKI_1 RGCY 5 cut(s) 55, 90, 133, 197, 290
Eam1104I CTCTTC 1 cut(s) 210
EarI CTCTTC 1 cut(s) 210
Ecl136II GAGCTC 2 cut(s) 55, 90
Eco24I GRGCYC 2 cut(s) 57, 92
Eco47I GGWCC 1 cut(s) 102
Eco53kI GAGCTC 2 cut(s) 55, 90
EcoICRI GAGCTC 2 cut(s) 55, 90
EcoT38I GRGCYC 2 cut(s) 57, 92
FaeI CATG 1 cut(s) 73
FaiI YATR 2 cut(s) 71, 273
FatI CATG 1 cut(s) 69
FokI GGATG 1 cut(s) 296
FriOI GRGCYC 2 cut(s) 57, 92
FspBI CTAG 1 cut(s) 111
Hin1II CATG 1 cut(s) 73
HinfI GANTC 1 cut(s) 155
HphI GGTGA 1 cut(s) 179
Hpy166II GTNNAC 1 cut(s) 105
Hpy188I TCNGA 2 cut(s) 160, 178
Hpy8I GTNNAC 1 cut(s) 105
HpyAV CCTTC 2 cut(s) 53, 93
HpyCH4III ACNGT 2 cut(s) 206, 299
HpyCH4IV ACGT 1 cut(s) 94
HpySE526I ACGT 1 cut(s) 94
Hsp92II CATG 1 cut(s) 73
LpnPI CCDG 1 cut(s) 156
MaeI CTAG 1 cut(s) 111
MaeII ACGT 1 cut(s) 94
MaeIII GTNAC 3 cut(s) 74, 82, 206
MboII GAAGA 1 cut(s) 227
MhlI GDGCHC 2 cut(s) 57, 92
MnlI CCTC 6 cut(s) 132, 135, 217, 223, 238, 274
MseI TTAA 2 cut(s) 12, 304
MslI CAYNNNNRTG 2 cut(s) 68, 276
NlaIII CATG 1 cut(s) 73
NmuCI GTSAC 1 cut(s) 206
PfeI GAWTC 1 cut(s) 155
Ppu21I YACGTR 1 cut(s) 95
Psp124BI GAGCTC 2 cut(s) 57, 92
PspPI GGNCC 1 cut(s) 102
RseI CAYNNNNRTG 2 cut(s) 68, 276
SacI GAGCTC 2 cut(s) 57, 92
SaqAI TTAA 2 cut(s) 12, 304
Sau96I GGNCC 1 cut(s) 102
SduI GDGCHC 2 cut(s) 57, 92
SetI ASST 7 cut(s) 57, 92, 97, 104, 199, 228, 292
SgeI CNNG 9 cut(s) 31, 68, 82, 99, 105, 123, 155, 223, 247
SinI GGWCC 1 cut(s) 102
SmiMI CAYNNNNRTG 2 cut(s) 68, 276
SpeI ACTAGT 1 cut(s) 110
SspMI CTAG 1 cut(s) 111
SstI GAGCTC 2 cut(s) 57, 92
TaaI ACNGT 2 cut(s) 206, 299
TaiI ACGT 1 cut(s) 97
TaqI TCGA 1 cut(s) 57
TfiI GAWTC 1 cut(s) 155
Tru1I TTAA 2 cut(s) 12, 304
Tru9I TTAA 2 cut(s) 12, 304
TscAI CASTG 2 cut(s) 211, 304
TseFI GTSAC 1 cut(s) 206
Tsp45I GTSAC 1 cut(s) 206
TspDTI ATGAA 2 cut(s) 207, 300
TspRI CASTG 2 cut(s) 211, 304
VpaK11BI GGWCC 1 cut(s) 102
XspI CTAG 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.