pycom15g31440

Catalyzes the formation of 5-oxoproline from gamma- glutamyl dipeptides and plays a significant role in glutathione (GSH) homeostasis

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
N/A
Physical Location & Seq
Reverse (-)
29881297 .. 29882045
749 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 282 bp
ATGGCTTTCTTCTCTGGAAGGCTGGTTTTAACTACGACGAGCGCCTCGCCGGCTTTCAACAAAGGCTATCGCCGTGTCTTCTACCAAGGCATTACGGACCATAGAGGGACGCCTGAGTATCCAGGAAGAACAGTCACATTGGAACCCGCAGAAGGAGAAATCTGTTGGGGCGTTGCCTACAAGATCTCGAAGAAGGAAGATCAAGAAGTTGCTGTAACGGTAGATTCTTATATATCAAAAGGTTGTTTTCACTATAATTTGGTCTTTTTGCTGGTCATATGA

Protein Analysis

94

Amino Acids

10.44

Weight (kDa)

7.78

Isoelectric Point (pI)

39.54

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ChaC PF04752 15 - 71 2.2e-16 ChaC-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 147
AcyI GRCGYC 1 cut(s) 110
AfiI CCNNNNNNNGG 1 cut(s) 152
AgsI TTSAA 1 cut(s) 58
AjnI CCWGG 1 cut(s) 121
AspLEI GCGC 1 cut(s) 44
AspS9I GGNCC 1 cut(s) 97
AvaII GGWCC 1 cut(s) 97
BbsI GAAGAC 1 cut(s) 70
BceAI ACGGC 1 cut(s) 57
BciT130I CCWGG 1 cut(s) 123
BciVI GTATCC 1 cut(s) 129
BfoI RGCGCY 1 cut(s) 45
BfuI GTATCC 1 cut(s) 129
BglI GCCNNNNNGGC 1 cut(s) 50
BglII AGATCT 1 cut(s) 183
Bme1390I CCNGG 1 cut(s) 123
Bme18I GGWCC 1 cut(s) 97
BmgT120I GGNCC 1 cut(s) 97
BmiI GGNNCC 1 cut(s) 144
BmrFI CCNGG 1 cut(s) 123
BpiI GAAGAC 1 cut(s) 70
BsaHI GRCGYC 1 cut(s) 110
BsaJI CCNNGG 1 cut(s) 85
Bsc4I CCNNNNNNNGG 1 cut(s) 152
Bse118I RCCGGY 1 cut(s) 49
BseBI CCWGG 1 cut(s) 123
BseDI CCNNGG 1 cut(s) 85
BseLI CCNNNNNNNGG 1 cut(s) 152
BseMII CTCAG 1 cut(s) 105
BsiSI CCGG 1 cut(s) 50
BslFI GGGAC 1 cut(s) 121
BslI CCNNNNNNNGG 1 cut(s) 152
BsmFI GGGAC 1 cut(s) 121
Bsp143I GATC 2 cut(s) 183, 199
BspACI CCGC 1 cut(s) 147
BspCNI CTCAG 1 cut(s) 106
BspLI GGNNCC 1 cut(s) 144
BsrFI RCCGGY 1 cut(s) 49
BssAI RCCGGY 1 cut(s) 49
BssECI CCNNGG 1 cut(s) 85
BssMI GATC 2 cut(s) 183, 199
BssNI GRCGYC 1 cut(s) 110
BssT1I CCWWGG 1 cut(s) 85
Bst2UI CCWGG 1 cut(s) 123
Bst4CI ACNGT 2 cut(s) 133, 220
BstACI GRCGYC 1 cut(s) 110
BstC8I GCNNGC 1 cut(s) 51
BstDEI CTNAG 1 cut(s) 114
BstH2I RGCGCY 1 cut(s) 45
BstHHI GCGC 1 cut(s) 44
BstKTI GATC 2 cut(s) 186, 202
BstMBI GATC 2 cut(s) 183, 199
BstMWI GCNNNNNNNGC 1 cut(s) 50
BstNI CCWGG 1 cut(s) 123
BstSCI CCNGG 1 cut(s) 121
BstV2I GAAGAC 1 cut(s) 70
BstX2I RGATCY 1 cut(s) 183
BstYI RGATCY 1 cut(s) 183
BsuI GTATCC 1 cut(s) 129
Cac8I GCNNGC 1 cut(s) 51
CfoI GCGC 1 cut(s) 44
Cfr10I RCCGGY 1 cut(s) 49
Cfr13I GGNCC 1 cut(s) 97
CseI GACGC 1 cut(s) 118
CviJI RGCY 4 cut(s) 5, 22, 53, 66
CviKI_1 RGCY 4 cut(s) 5, 22, 53, 66
DdeI CTNAG 1 cut(s) 114
DpnI GATC 2 cut(s) 185, 201
DpnII GATC 2 cut(s) 183, 199
Eco130I CCWWGG 1 cut(s) 85
Eco47I GGWCC 1 cut(s) 97
EcoRII CCWGG 1 cut(s) 121
EcoT14I CCWWGG 1 cut(s) 85
ErhI CCWWGG 1 cut(s) 85
FaiI YATR 6 cut(s) 102, 231, 233, 255, 278, 280
FaqI GGGAC 1 cut(s) 121
FauI CCCGC 1 cut(s) 154
FauNDI CATATG 1 cut(s) 278
GlaI GCGC 1 cut(s) 43
HaeII RGCGCY 1 cut(s) 45
HapII CCGG 1 cut(s) 50
HgaI GACGC 1 cut(s) 118
HhaI GCGC 1 cut(s) 44
Hin1I GRCGYC 1 cut(s) 110
Hin6I GCGC 1 cut(s) 42
HinP1I GCGC 1 cut(s) 42
HinfI GANTC 1 cut(s) 224
HpaII CCGG 1 cut(s) 50
Hpy188III TCNNGA 3 cut(s) 15, 187, 203
Hpy99I CGWCG 1 cut(s) 40
HpyAV CCTTC 3 cut(s) 12, 146, 187
HpyCH4III ACNGT 2 cut(s) 133, 220
HpyF10VI GCNNNNNNNGC 1 cut(s) 50
HpyF3I CTNAG 1 cut(s) 114
Hsp92I GRCGYC 1 cut(s) 110
HspAI GCGC 1 cut(s) 42
KroI GCCGGC 1 cut(s) 49
KroNI GCCGGC 1 cut(s) 51
Kzo9I GATC 2 cut(s) 183, 199
LpnPI CCDG 6 cut(s) 8, 63, 108, 126, 135, 257
MaeIII GTNAC 2 cut(s) 133, 214
MalI GATC 2 cut(s) 185, 201
MboI GATC 2 cut(s) 183, 199
MboII GAAGA 4 cut(s) 70, 138, 202, 209
MflI RGATCY 1 cut(s) 183
MluCI AATT 1 cut(s) 256
MnlI CCTC 2 cut(s) 55, 98
MroNI GCCGGC 1 cut(s) 49
MseI TTAA 1 cut(s) 29
MspI CCGG 1 cut(s) 50
MspR9I CCNGG 1 cut(s) 123
MvaI CCWGG 1 cut(s) 123
MwoI GCNNNNNNNGC 1 cut(s) 50
NaeI GCCGGC 1 cut(s) 51
NdeI CATATG 1 cut(s) 278
NdeII GATC 2 cut(s) 183, 199
NgoMIV GCCGGC 1 cut(s) 49
NlaIV GGNNCC 1 cut(s) 144
NmuCI GTSAC 1 cut(s) 133
PdiI GCCGGC 1 cut(s) 51
PfeI GAWTC 1 cut(s) 224
PfoI TCCNGGA 1 cut(s) 121
Psp6I CCWGG 1 cut(s) 121
PspGI CCWGG 1 cut(s) 121
PspN4I GGNNCC 1 cut(s) 144
PspPI GGNCC 1 cut(s) 97
PsuI RGATCY 1 cut(s) 183
SaqAI TTAA 1 cut(s) 29
Sau3AI GATC 2 cut(s) 183, 199
Sau96I GGNCC 1 cut(s) 97
ScrFI CCNGG 1 cut(s) 123
SetI ASST 1 cut(s) 244
SinI GGWCC 1 cut(s) 97
Sse9I AATT 1 cut(s) 256
SsiI CCGC 1 cut(s) 147
StyD4I CCNGG 1 cut(s) 121
StyI CCWWGG 1 cut(s) 85
TaaI ACNGT 2 cut(s) 133, 220
TaqI TCGA 1 cut(s) 188
TasI AATT 1 cut(s) 256
TfiI GAWTC 1 cut(s) 224
Tru1I TTAA 1 cut(s) 29
Tru9I TTAA 1 cut(s) 29
TseFI GTSAC 1 cut(s) 133
Tsp45I GTSAC 1 cut(s) 133
TspGWI ACGGA 1 cut(s) 110
VpaK11BI GGWCC 1 cut(s) 97
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.