pycom15g31660

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
N/A
Physical Location & Seq
Reverse (-)
30221056 .. 30221438
383 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 252 bp
ATGGGGCAAAATTATAACCAAAAAAAAGTTTGGACACCATGTAATTTTGTTCTTTGTACAACAACTGCTTTGGAAACTGCAAACAAGTTAATTCAGTCAACAAACTCAAATGTCATGTCATTGTCGGAGAAGGTTGGAGAGCTTGAGGGAGTTATCAAGAGGGCAGATTCTGCCATATCAGCAGCAAGGGTCGTTCATGGTTCACTAAACAAAAAGGAAGGACCACTTATTGGCAATCAAAATGCCAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

84

Amino Acids

8.95

Weight (kDa)

9.34

Isoelectric Point (pI)

21.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 15
AccB7I CCANNNNNTGG 1 cut(s) 230
AfaI GTAC 1 cut(s) 58
AfiI CCNNNNNNNGG 1 cut(s) 230
AluBI AGCT 1 cut(s) 142
AluI AGCT 1 cut(s) 142
AlwNI CAGNNNCTG 1 cut(s) 170
ApeKI GCWGC 1 cut(s) 182
ArsI GACNNNNNNTTYG 2 cut(s) 101, 133
AspS9I GGNCC 1 cut(s) 221
AvaII GGWCC 1 cut(s) 221
BbvI GCAGC 1 cut(s) 194
BisI GCNGC 1 cut(s) 183
BlsI GCNGC 1 cut(s) 184
Bme18I GGWCC 1 cut(s) 221
BmgT120I GGNCC 1 cut(s) 221
BpuEI CTTGAG 1 cut(s) 164
Bsc4I CCNNNNNNNGG 1 cut(s) 230
BseLI CCNNNNNNNGG 1 cut(s) 230
BseXI GCAGC 1 cut(s) 194
BslI CCNNNNNNNGG 1 cut(s) 230
Bsp1407I TGTACA 1 cut(s) 56
BsrGI TGTACA 1 cut(s) 56
BstAPI GCANNNNNTGC 1 cut(s) 170
BstAUI TGTACA 1 cut(s) 56
BstMWI GCNNNNNNNGC 2 cut(s) 170, 179
BstV1I GCAGC 1 cut(s) 194
CaiI CAGNNNCTG 1 cut(s) 170
Cfr13I GGNCC 1 cut(s) 221
Csp6I GTAC 1 cut(s) 57
CviAII CATG 3 cut(s) 39, 115, 197
CviJI RGCY 1 cut(s) 142
CviKI_1 RGCY 1 cut(s) 142
CviQI GTAC 1 cut(s) 57
Eco47I GGWCC 1 cut(s) 221
FaeI CATG 3 cut(s) 42, 118, 200
FaiI YATR 5 cut(s) 15, 40, 116, 176, 198
FalI AAGNNNNNCTT 2 cut(s) 210, 242
FatI CATG 3 cut(s) 38, 114, 196
Fnu4HI GCNGC 1 cut(s) 183
Fsp4HI GCNGC 1 cut(s) 183
GluI GCNGC 1 cut(s) 183
Hin1II CATG 3 cut(s) 42, 118, 200
HincII GTYRAC 1 cut(s) 99
HindII GTYRAC 1 cut(s) 99
HinfI GANTC 1 cut(s) 167
Hpy166II GTNNAC 2 cut(s) 99, 203
Hpy188I TCNGA 1 cut(s) 127
Hpy188III TCNNGA 1 cut(s) 157
Hpy8I GTNNAC 2 cut(s) 99, 203
HpyAV CCTTC 2 cut(s) 124, 212
HpyCH4V TGCA 1 cut(s) 80
HpyF10VI GCNNNNNNNGC 2 cut(s) 170, 179
Hsp92II CATG 3 cut(s) 42, 118, 200
Lsp1109I GCAGC 1 cut(s) 194
MluCI AATT 3 cut(s) 10, 43, 90
MmeI TCCRAC 2 cut(s) 105, 115
MnlI CCTC 2 cut(s) 139, 153
MseI TTAA 1 cut(s) 89
MwoI GCNNNNNNNGC 2 cut(s) 170, 179
NlaIII CATG 3 cut(s) 42, 118, 200
PfeI GAWTC 1 cut(s) 167
PflMI CCANNNNNTGG 1 cut(s) 230
PkrI GCNGC 1 cut(s) 184
PsiI TTATAA 1 cut(s) 15
PspPI GGNCC 1 cut(s) 221
PstNI CAGNNNCTG 1 cut(s) 170
RsaI GTAC 1 cut(s) 58
RsaNI GTAC 1 cut(s) 57
SaqAI TTAA 1 cut(s) 89
SatI GCNGC 1 cut(s) 183
Sau96I GGNCC 1 cut(s) 221
SetI ASST 2 cut(s) 135, 144
SgeI CNNG 7 cut(s) 51, 97, 127, 155, 169, 198, 209
SinI GGWCC 1 cut(s) 221
SmlI CTYRAG 1 cut(s) 143
SmoI CTYRAG 1 cut(s) 143
Sse9I AATT 3 cut(s) 10, 43, 90
TasI AATT 3 cut(s) 10, 43, 90
TatI WGTACW 1 cut(s) 56
TfiI GAWTC 1 cut(s) 167
Tru1I TTAA 1 cut(s) 89
Tru9I TTAA 1 cut(s) 89
TseI GCWGC 1 cut(s) 182
TspDTI ATGAA 1 cut(s) 185
Van91I CCANNNNNTGG 1 cut(s) 230
VpaK11BI GGWCC 1 cut(s) 221
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.