pycom15g38320

Ion channel

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
N/A
Physical Location & Seq
Forward (+)
38134363 .. 38134617
255 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 255 bp
ATGACCAGAGCTTTGTATTATTTTGTGCTTGAACAGGGAAATGAGATGTGCATTAAACCAGCAGAACTGTATTTGTATGACCAGGAAGAACTGTCCTTTTACGATATTGTGCTCAGGGGTCGTCAAAGGCAGGAAATCGTGATTGGATATCGCCTTGTAAACACAGAGCGAGCCATGATTAATCCATCACCGAAGTTGGAGGTAAGGAAATGGTCCCATGATGATGTTTTCGTGGTTATCTCCATAAGTGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

85

Amino Acids

10.02

Weight (kDa)

5.13

Isoelectric Point (pI)

43.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 32
AjnI CCWGG 1 cut(s) 81
AjuI GAANNNNNNNTTGG 2 cut(s) 126, 158
AluBI AGCT 1 cut(s) 11
AluI AGCT 1 cut(s) 11
Alw21I GWGCWC 1 cut(s) 114
ArsI GACNNNNNNTTYG 1 cut(s) 27
AseI ATTAAT 1 cut(s) 180
AspS9I GGNCC 1 cut(s) 213
AsuHPI GGTGA 1 cut(s) 180
AvaII GGWCC 1 cut(s) 213
Bbv12I GWGCWC 1 cut(s) 114
BccI CCATC 1 cut(s) 193
BciT130I CCWGG 1 cut(s) 83
Bme1390I CCNGG 1 cut(s) 83
Bme18I GGWCC 1 cut(s) 213
BmgT120I GGNCC 1 cut(s) 213
BmiI GGNNCC 1 cut(s) 215
BmrFI CCNGG 1 cut(s) 83
Bpu10I CCTNAGC 1 cut(s) 113
BseBI CCWGG 1 cut(s) 83
BseMII CTCAG 1 cut(s) 127
BsiHKAI GWGCWC 1 cut(s) 114
BslFI GGGAC 1 cut(s) 199
BsmFI GGGAC 1 cut(s) 199
Bsp1286I GDGCHC 1 cut(s) 114
BspCNI CTCAG 1 cut(s) 126
BspLI GGNNCC 1 cut(s) 215
Bst2UI CCWGG 1 cut(s) 83
Bst4CI ACNGT 2 cut(s) 69, 93
BstC8I GCNNGC 1 cut(s) 171
BstDEI CTNAG 1 cut(s) 113
BstNI CCWGG 1 cut(s) 83
BstSCI CCNGG 1 cut(s) 81
Cac8I GCNNGC 1 cut(s) 171
Cfr13I GGNCC 1 cut(s) 213
CviAII CATG 2 cut(s) 175, 218
CviJI RGCY 2 cut(s) 11, 173
CviKI_1 RGCY 2 cut(s) 11, 173
DdeI CTNAG 1 cut(s) 113
Eco32I GATATC 1 cut(s) 149
Eco47I GGWCC 1 cut(s) 213
EcoRII CCWGG 1 cut(s) 81
EcoRV GATATC 1 cut(s) 149
FaeI CATG 2 cut(s) 178, 221
FaiI YATR 4 cut(s) 78, 176, 219, 245
FaqI GGGAC 1 cut(s) 199
FatI CATG 2 cut(s) 174, 217
Hin1II CATG 2 cut(s) 178, 221
HphI GGTGA 1 cut(s) 180
Hpy166II GTNNAC 1 cut(s) 160
Hpy188III TCNNGA 1 cut(s) 139
Hpy8I GTNNAC 1 cut(s) 160
HpyCH4III ACNGT 2 cut(s) 69, 93
HpyCH4V TGCA 1 cut(s) 51
HpyF3I CTNAG 1 cut(s) 113
Hsp92II CATG 2 cut(s) 178, 221
LpnPI CCDG 7 cut(s) 19, 20, 68, 72, 95, 100, 116
MboII GAAGA 1 cut(s) 98
MhlI GDGCHC 1 cut(s) 114
MmeI TCCRAC 1 cut(s) 177
MnlI CCTC 1 cut(s) 193
MseI TTAA 2 cut(s) 54, 180
MslI CAYNNNNRTG 1 cut(s) 222
MspR9I CCNGG 1 cut(s) 83
MvaI CCWGG 1 cut(s) 83
NlaIII CATG 2 cut(s) 178, 221
NlaIV GGNNCC 1 cut(s) 215
PshBI ATTAAT 1 cut(s) 180
Psp6I CCWGG 1 cut(s) 81
PspGI CCWGG 1 cut(s) 81
PspN4I GGNNCC 1 cut(s) 215
PspPI GGNCC 1 cut(s) 213
RseI CAYNNNNRTG 1 cut(s) 222
SaqAI TTAA 2 cut(s) 54, 180
Sau96I GGNCC 1 cut(s) 213
ScrFI CCNGG 1 cut(s) 83
SduI GDGCHC 1 cut(s) 114
SetI ASST 2 cut(s) 13, 204
SinI GGWCC 1 cut(s) 213
SmiMI CAYNNNNRTG 1 cut(s) 222
StyD4I CCNGG 1 cut(s) 81
TaaI ACNGT 2 cut(s) 69, 93
Tru1I TTAA 2 cut(s) 54, 180
Tru9I TTAA 2 cut(s) 54, 180
VpaK11BI GGWCC 1 cut(s) 213
VspI ATTAAT 1 cut(s) 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.