pycom16g01660

Microtubule-associated protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
N/A
Physical Location & Seq
Forward (+)
1026961 .. 1027345
385 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 192 bp
ATGGAGGTTGAAGCAAAGAAAATGAGAAGAGAAGTTGCTGCCATGGAGAAGGAGGTAGCTGCCATGCGTGTGGACAAAGAACATGAGAATAGGGCCAAGCGGTTTGGTCATACTAAAAGTTCCGTCAGCAGTGCTCAGGTGCTCTCTGGAAGGGGTCTCGCACGAAGTGGGTTAACACGCAGCACCCAATGA

Protein Analysis

64

Amino Acids

7.02

Weight (kDa)

10.57

Isoelectric Point (pI)

37.08

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
MAP70 PF07058 1 - 47 5.5e-15 Microtubule-associated protein 70
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 100
AdeI CACNNNGTG 1 cut(s) 167
AgsI TTSAA 1 cut(s) 11
AluBI AGCT 1 cut(s) 59
AluI AGCT 1 cut(s) 59
Alw21I GWGCWC 2 cut(s) 136, 144
Alw26I GTCTC 1 cut(s) 161
AoxI GGCC 1 cut(s) 93
ApeKI GCWGC 3 cut(s) 38, 59, 180
AspS9I GGNCC 1 cut(s) 93
Bbv12I GWGCWC 2 cut(s) 136, 144
BbvI GCAGC 2 cut(s) 25, 46
BcoDI GTCTC 1 cut(s) 161
BisI GCNGC 3 cut(s) 39, 60, 181
BlsI GCNGC 3 cut(s) 40, 61, 182
BmgT120I GGNCC 1 cut(s) 93
Bpu10I CCTNAGC 1 cut(s) 135
BsaI GGTCTC 1 cut(s) 161
BsaJI CCNNGG 1 cut(s) 42
BseDI CCNNGG 1 cut(s) 42
BseMII CTCAG 1 cut(s) 149
BseXI GCAGC 2 cut(s) 25, 46
BshFI GGCC 1 cut(s) 95
BsiHKAI GWGCWC 2 cut(s) 136, 144
BsmAI GTCTC 1 cut(s) 161
BsnI GGCC 1 cut(s) 95
Bso31I GGTCTC 1 cut(s) 161
Bsp1286I GDGCHC 2 cut(s) 136, 144
Bsp19I CCATGG 1 cut(s) 42
BspACI CCGC 1 cut(s) 100
BspANI GGCC 1 cut(s) 95
BspCNI CTCAG 1 cut(s) 148
BspTNI GGTCTC 1 cut(s) 161
BssECI CCNNGG 1 cut(s) 42
BssT1I CCWWGG 1 cut(s) 42
Bst6I CTCTTC 1 cut(s) 22
BstDEI CTNAG 1 cut(s) 135
BstDSI CCRYGG 1 cut(s) 42
BstMAI GTCTC 1 cut(s) 161
BstV1I GCAGC 2 cut(s) 25, 46
BstXI CCANNNNNNTGG 1 cut(s) 70
BsuRI GGCC 1 cut(s) 95
BtgI CCRYGG 1 cut(s) 42
BtsI GCAGTG 1 cut(s) 136
BtsIMutI CAGTG 1 cut(s) 136
Cfr13I GGNCC 1 cut(s) 93
CviAII CATG 3 cut(s) 43, 64, 83
CviJI RGCY 2 cut(s) 59, 95
CviKI_1 RGCY 2 cut(s) 59, 95
DdeI CTNAG 1 cut(s) 135
DraIII CACNNNGTG 1 cut(s) 167
Eam1104I CTCTTC 1 cut(s) 22
EarI CTCTTC 1 cut(s) 22
Eco130I CCWWGG 1 cut(s) 42
Eco31I GGTCTC 1 cut(s) 161
EcoT14I CCWWGG 1 cut(s) 42
ErhI CCWWGG 1 cut(s) 42
FaeI CATG 3 cut(s) 46, 67, 86
FaiI YATR 4 cut(s) 44, 65, 84, 111
FatI CATG 3 cut(s) 42, 63, 82
Fnu4HI GCNGC 3 cut(s) 39, 60, 181
Fsp4HI GCNGC 3 cut(s) 39, 60, 181
GluI GCNGC 3 cut(s) 39, 60, 181
HaeIII GGCC 1 cut(s) 95
Hin1II CATG 3 cut(s) 46, 67, 86
HincII GTYRAC 1 cut(s) 174
HindII GTYRAC 1 cut(s) 174
HpaI GTTAAC 1 cut(s) 174
Hpy166II GTNNAC 2 cut(s) 73, 174
Hpy188III TCNNGA 1 cut(s) 147
Hpy8I GTNNAC 2 cut(s) 73, 174
HpyAV CCTTC 2 cut(s) 43, 144
HpyF3I CTNAG 1 cut(s) 135
Hsp92II CATG 3 cut(s) 46, 67, 86
KspAI GTTAAC 1 cut(s) 174
LpnPI CCDG 2 cut(s) 122, 132
Lsp1109I GCAGC 2 cut(s) 25, 46
MboII GAAGA 1 cut(s) 39
MhlI GDGCHC 2 cut(s) 136, 144
MnlI CCTC 1 cut(s) 46
MseI TTAA 1 cut(s) 173
MslI CAYNNNNRTG 1 cut(s) 68
NcoI CCATGG 1 cut(s) 42
NlaIII CATG 3 cut(s) 46, 67, 86
PkrI GCNGC 3 cut(s) 40, 61, 182
PspPI GGNCC 1 cut(s) 93
RseI CAYNNNNRTG 1 cut(s) 68
SaqAI TTAA 1 cut(s) 173
SatI GCNGC 3 cut(s) 39, 60, 181
Sau96I GGNCC 1 cut(s) 93
SduI GDGCHC 2 cut(s) 136, 144
SetI ASST 4 cut(s) 9, 57, 61, 141
SgeI CNNG 9 cut(s) 55, 76, 80, 95, 109, 149, 159, 170, 174
SmiMI CAYNNNNRTG 1 cut(s) 68
SsiI CCGC 1 cut(s) 100
StyI CCWWGG 1 cut(s) 42
Tru1I TTAA 1 cut(s) 173
Tru9I TTAA 1 cut(s) 173
TscAI CASTG 1 cut(s) 136
TseI GCWGC 3 cut(s) 38, 59, 180
TspGWI ACGGA 1 cut(s) 112
TspRI CASTG 1 cut(s) 136
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.