pycom16g02390

Belongs to the MIP aquaporin (TC 1.A.8) family

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
N/A
Physical Location & Seq
Forward (+)
1530675 .. 1531149
475 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 183 bp
ATGCAGATCATTGCCTCTTTTGTCTGGATGTTTGTTATTTCAGGCATCGCCACAGATAGTAGAGCTATTGCAGAATTGGCAGGAATTGCTGTAGGAATGACAATAACTATGGACGTCCCCGTTGCCAGGGACAGAAAAAAACTGCCTTTACTAAATTTAGCTATTAGAGGCGAATGCAATTAG

Protein Analysis

61

Amino Acids

6.49

Weight (kDa)

7.95

Isoelectric Point (pI)

25.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 117
AcsI RAATTY 1 cut(s) 154
AcyI GRCGYC 1 cut(s) 114
AfiI CCNNNNNNNGG 1 cut(s) 126
AjnI CCWGG 1 cut(s) 125
AluBI AGCT 2 cut(s) 65, 161
AluI AGCT 2 cut(s) 65, 161
ApoI RAATTY 1 cut(s) 154
BciT130I CCWGG 1 cut(s) 127
BfmI CTRYAG 1 cut(s) 90
Bme1390I CCNGG 1 cut(s) 127
BmrFI CCNGG 1 cut(s) 127
BmsI GCATC 1 cut(s) 54
BsaHI GRCGYC 1 cut(s) 114
BsaJI CCNNGG 1 cut(s) 126
Bsc4I CCNNNNNNNGG 1 cut(s) 126
Bse3DI GCAATG 1 cut(s) 9
BseBI CCWGG 1 cut(s) 127
BseDI CCNNGG 1 cut(s) 126
BseGI GGATG 1 cut(s) 33
BseLI CCNNNNNNNGG 1 cut(s) 126
BseMI GCAATG 1 cut(s) 9
BslFI GGGAC 2 cut(s) 101, 143
BslI CCNNNNNNNGG 1 cut(s) 126
BsmFI GGGAC 2 cut(s) 101, 143
BsmI GAATGC 1 cut(s) 179
Bsp143I GATC 1 cut(s) 6
BsrDI GCAATG 1 cut(s) 9
BssECI CCNNGG 1 cut(s) 126
BssMI GATC 1 cut(s) 6
BssNI GRCGYC 1 cut(s) 114
Bst2UI CCWGG 1 cut(s) 127
BstACI GRCGYC 1 cut(s) 114
BstAPI GCANNNNNTGC 1 cut(s) 86
BstF5I GGATG 1 cut(s) 33
BstKTI GATC 1 cut(s) 9
BstMBI GATC 1 cut(s) 6
BstMWI GCNNNNNNNGC 2 cut(s) 77, 86
BstNI CCWGG 1 cut(s) 127
BstSCI CCNGG 1 cut(s) 125
BstSFI CTRYAG 1 cut(s) 90
BtgZI GCGATG 1 cut(s) 31
BtsCI GGATG 1 cut(s) 33
CviJI RGCY 2 cut(s) 65, 161
CviKI_1 RGCY 2 cut(s) 65, 161
DpnI GATC 1 cut(s) 8
DpnII GATC 1 cut(s) 6
EcoRII CCWGG 1 cut(s) 125
FaiI YATR 1 cut(s) 110
FaqI GGGAC 2 cut(s) 101, 143
FokI GGATG 1 cut(s) 40
Hin1I GRCGYC 1 cut(s) 114
Hpy188III TCNNGA 1 cut(s) 25
HpyCH4IV ACGT 1 cut(s) 114
HpyCH4V TGCA 3 cut(s) 4, 71, 177
HpyF10VI GCNNNNNNNGC 2 cut(s) 77, 86
HpySE526I ACGT 1 cut(s) 114
Hsp92I GRCGYC 1 cut(s) 114
Kzo9I GATC 1 cut(s) 6
LpnPI CCDG 5 cut(s) 10, 27, 66, 112, 139
LweI GCATC 1 cut(s) 54
MaeII ACGT 1 cut(s) 114
MalI GATC 1 cut(s) 8
MboI GATC 1 cut(s) 6
MluCI AATT 4 cut(s) 74, 84, 154, 178
MnlI CCTC 2 cut(s) 25, 161
MspR9I CCNGG 1 cut(s) 127
Mva1269I GAATGC 1 cut(s) 179
MvaI CCWGG 1 cut(s) 127
MwoI GCNNNNNNNGC 2 cut(s) 77, 86
NdeII GATC 1 cut(s) 6
PctI GAATGC 1 cut(s) 179
Psp6I CCWGG 1 cut(s) 125
PspGI CCWGG 1 cut(s) 125
Sau3AI GATC 1 cut(s) 6
ScrFI CCNGG 1 cut(s) 127
SetI ASST 3 cut(s) 67, 117, 163
SfaNI GCATC 1 cut(s) 54
SfcI CTRYAG 1 cut(s) 90
SgeI CNNG 6 cut(s) 37, 54, 93, 131, 138, 139
Sse9I AATT 4 cut(s) 74, 84, 154, 178
StyD4I CCNGG 1 cut(s) 125
TaiI ACGT 1 cut(s) 117
TasI AATT 4 cut(s) 74, 84, 154, 178
XapI RAATTY 1 cut(s) 154
ZraI GACGTC 1 cut(s) 115
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.