pycom16g06240

Beta-1,3-galactosyltransferase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
N/A
Physical Location & Seq
Reverse (-)
3990340 .. 3990555
216 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 216 bp
ATGAAGACAGATGACGATGCATTTGTTCGTGTGGATGAAGTGCTAGCTTCCTTACACAGGATCAAAGTGAATCGTGGCTTGCTTTATGGCCTCATTAACTCAGATTCACGACCTCATCGAAATCCAGAGAGCAAATGGTACATCAGCTCTGAGGTAATTTTCAAGCTTTGCCAACGTTGCAAGCTCTGGTATAACTCGGTTTGTTCCCCAAATTAG

Protein Analysis

72

Amino Acids

8.31

Weight (kDa)

8.93

Isoelectric Point (pI)

26.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 175
AclWI GGATC 1 cut(s) 68
AfaI GTAC 1 cut(s) 140
AfiI CCNNNNNNNGG 1 cut(s) 57
AgsI TTSAA 1 cut(s) 163
AluBI AGCT 4 cut(s) 47, 147, 166, 184
AluI AGCT 4 cut(s) 47, 147, 166, 184
AlwI GGATC 1 cut(s) 68
AoxI GGCC 1 cut(s) 88
ArsI GACNNNNNNTTYG 1 cut(s) 37
AsuNHI GCTAGC 1 cut(s) 43
BbsI GAAGAC 1 cut(s) 11
BfaI CTAG 1 cut(s) 44
BmsI GCATC 1 cut(s) 7
BmtI GCTAGC 1 cut(s) 47
BpiI GAAGAC 1 cut(s) 11
Bsc4I CCNNNNNNNGG 1 cut(s) 57
BseGI GGATG 1 cut(s) 40
BseLI CCNNNNNNNGG 1 cut(s) 57
BseMII CTCAG 2 cut(s) 114, 141
BshFI GGCC 1 cut(s) 90
BslI CCNNNNNNNGG 1 cut(s) 57
BsnI GGCC 1 cut(s) 90
Bsp143I GATC 1 cut(s) 60
BspANI GGCC 1 cut(s) 90
BspCNI CTCAG 2 cut(s) 113, 142
BspOI GCTAGC 1 cut(s) 47
BspPI GGATC 1 cut(s) 68
BssMI GATC 1 cut(s) 60
BstC8I GCNNGC 3 cut(s) 45, 80, 182
BstDEI CTNAG 2 cut(s) 100, 150
BstENI CCTNNNNNAGG 1 cut(s) 55
BstF5I GGATG 1 cut(s) 40
BstKTI GATC 1 cut(s) 63
BstMBI GATC 1 cut(s) 60
BstMWI GCNNNNNNNGC 1 cut(s) 177
BstV2I GAAGAC 1 cut(s) 11
BsuRI GGCC 1 cut(s) 90
BtsCI GGATG 1 cut(s) 40
Cac8I GCNNGC 3 cut(s) 45, 80, 182
Csp6I GTAC 1 cut(s) 139
CviJI RGCY 6 cut(s) 47, 78, 90, 147, 166, 184
CviKI_1 RGCY 6 cut(s) 47, 78, 90, 147, 166, 184
CviQI GTAC 1 cut(s) 139
DdeI CTNAG 2 cut(s) 100, 150
DpnI GATC 1 cut(s) 62
DpnII GATC 1 cut(s) 60
EcoNI CCTNNNNNAGG 1 cut(s) 55
EcoT22I ATGCAT 1 cut(s) 22
FaiI YATR 2 cut(s) 87, 192
FokI GGATG 1 cut(s) 47
FspBI CTAG 1 cut(s) 44
HaeIII GGCC 1 cut(s) 90
HindIII AAGCTT 1 cut(s) 164
HinfI GANTC 2 cut(s) 70, 104
Hpy188I TCNGA 2 cut(s) 103, 151
Hpy188III TCNNGA 2 cut(s) 108, 125
HpyCH4IV ACGT 1 cut(s) 175
HpyCH4V TGCA 2 cut(s) 20, 180
HpyF10VI GCNNNNNNNGC 1 cut(s) 177
HpyF3I CTNAG 2 cut(s) 100, 150
HpySE526I ACGT 1 cut(s) 175
Kzo9I GATC 1 cut(s) 60
LpnPI CCDG 3 cut(s) 43, 138, 172
LweI GCATC 1 cut(s) 7
MaeI CTAG 1 cut(s) 44
MaeII ACGT 1 cut(s) 175
MalI GATC 1 cut(s) 62
MboI GATC 1 cut(s) 60
MboII GAAGA 1 cut(s) 16
MluCI AATT 2 cut(s) 156, 211
MnlI CCTC 3 cut(s) 101, 123, 145
Mph1103I ATGCAT 1 cut(s) 22
MseI TTAA 1 cut(s) 96
MwoI GCNNNNNNNGC 1 cut(s) 177
NdeII GATC 1 cut(s) 60
NheI GCTAGC 1 cut(s) 43
NsiI ATGCAT 1 cut(s) 22
PcsI WCGNNNNNNNCGW 1 cut(s) 115
PfeI GAWTC 2 cut(s) 70, 104
Psp1406I AACGTT 1 cut(s) 175
RsaI GTAC 1 cut(s) 140
RsaNI GTAC 1 cut(s) 139
SaqAI TTAA 1 cut(s) 96
Sau3AI GATC 1 cut(s) 60
SetI ASST 7 cut(s) 49, 115, 149, 156, 168, 178, 186
SfaNI GCATC 1 cut(s) 7
Sse9I AATT 2 cut(s) 156, 211
SspMI CTAG 1 cut(s) 44
TaiI ACGT 1 cut(s) 178
TaqI TCGA 1 cut(s) 118
TasI AATT 2 cut(s) 156, 211
TfiI GAWTC 2 cut(s) 70, 104
Tru1I TTAA 1 cut(s) 96
Tru9I TTAA 1 cut(s) 96
TspDTI ATGAA 2 cut(s) 17, 51
XagI CCTNNNNNAGG 1 cut(s) 55
XcmI CCANNNNNNNNNTGG 1 cut(s) 132
XspI CTAG 1 cut(s) 44
Zsp2I ATGCAT 1 cut(s) 22
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.