pycom16g08900

This protein plays a role in synthesis of starch. It catalyzes the synthesis of the activated glycosyl donor, ADP- glucose from Glc-1-P and ATP

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
N/A
Physical Location & Seq
Forward (+)
5948959 .. 5949560
602 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 285 bp
ATGGATGCCATTATTTCTCATGGTTGCTTCTTGCAAGAATGTAGCGTTCAACACTCCATTGTGGGTATGCGCTCACGTCTAGAGGTAAAATCAGTTACGGATGGCAATTATGTAGGAATGCATGGATACATTGATAGGAAAATCTCATTATTTTGTTGGTCTTTTATCTTTAACCCTTGTAAACATGTACTTTATGAGGAATATTTATGTAGTTTCATTATAGACATTCCATTTCTACTATTGGGTTGCTTTTTACAGCAGAGGCTGCCATCTTTGATTTTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

95

Amino Acids

10.85

Weight (kDa)

6.38

Isoelectric Point (pI)

39.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LbH_GLGC PF25247 2 - 37 3e-07 GLGC left-handed parallel beta-helix domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 189
AflIII ACRYGT 1 cut(s) 184
AgsI TTSAA 1 cut(s) 50
AjiI CACGTC 1 cut(s) 77
AlwNI CAGNNNCTG 1 cut(s) 265
ApeKI GCWGC 1 cut(s) 265
AspLEI GCGC 1 cut(s) 72
BbvI GCAGC 1 cut(s) 252
BccI CCATC 2 cut(s) 95, 277
BciVI GTATCC 1 cut(s) 119
BfaI CTAG 1 cut(s) 80
BfuI GTATCC 1 cut(s) 119
BisI GCNGC 1 cut(s) 266
BlsI GCNGC 1 cut(s) 267
BmgBI CACGTC 1 cut(s) 77
BseGI GGATG 2 cut(s) 10, 106
BseXI GCAGC 1 cut(s) 252
BsmI GAATGC 1 cut(s) 123
BstAPI GCANNNNNTGC 1 cut(s) 265
BstF5I GGATG 2 cut(s) 10, 106
BstHHI GCGC 1 cut(s) 72
BstMWI GCNNNNNNNGC 1 cut(s) 265
BstNSI RCATGY 1 cut(s) 188
BstV1I GCAGC 1 cut(s) 252
BsuI GTATCC 1 cut(s) 119
BtrI CACGTC 1 cut(s) 77
BtsCI GGATG 2 cut(s) 10, 106
CaiI CAGNNNCTG 1 cut(s) 265
CfoI GCGC 1 cut(s) 72
Csp6I GTAC 1 cut(s) 188
CviAII CATG 3 cut(s) 20, 122, 185
CviJI RGCY 1 cut(s) 265
CviKI_1 RGCY 1 cut(s) 265
CviQI GTAC 1 cut(s) 188
EcoT22I ATGCAT 1 cut(s) 123
FaeI CATG 3 cut(s) 23, 125, 188
FaiI YATR 9 cut(s) 21, 68, 111, 123, 186, 195, 208, 221, 283
FatI CATG 3 cut(s) 19, 121, 184
Fnu4HI GCNGC 1 cut(s) 266
FokI GGATG 2 cut(s) 17, 113
Fsp4HI GCNGC 1 cut(s) 266
FspBI CTAG 1 cut(s) 80
GlaI GCGC 1 cut(s) 71
GluI GCNGC 1 cut(s) 266
HhaI GCGC 1 cut(s) 72
Hin1II CATG 3 cut(s) 23, 125, 188
Hin6I GCGC 1 cut(s) 70
HinP1I GCGC 1 cut(s) 70
Hpy166II GTNNAC 1 cut(s) 182
Hpy188III TCNNGA 1 cut(s) 80
Hpy8I GTNNAC 1 cut(s) 182
HpyCH4IV ACGT 1 cut(s) 76
HpyCH4V TGCA 2 cut(s) 34, 121
HpyF10VI GCNNNNNNNGC 1 cut(s) 265
HpySE526I ACGT 1 cut(s) 76
Hsp92II CATG 3 cut(s) 23, 125, 188
HspAI GCGC 1 cut(s) 70
Lsp1109I GCAGC 1 cut(s) 252
MaeI CTAG 1 cut(s) 80
MaeII ACGT 1 cut(s) 76
MaeIII GTNAC 1 cut(s) 94
MluCI AATT 1 cut(s) 106
MnlI CCTC 3 cut(s) 76, 190, 255
Mph1103I ATGCAT 1 cut(s) 123
MseI TTAA 1 cut(s) 171
Mva1269I GAATGC 1 cut(s) 123
MwoI GCNNNNNNNGC 1 cut(s) 265
NlaIII CATG 3 cut(s) 23, 125, 188
NsiI ATGCAT 1 cut(s) 123
NspI RCATGY 1 cut(s) 188
PciI ACATGT 1 cut(s) 184
PctI GAATGC 1 cut(s) 123
PkrI GCNGC 1 cut(s) 267
PscI ACATGT 1 cut(s) 184
PstNI CAGNNNCTG 1 cut(s) 265
RsaI GTAC 1 cut(s) 189
RsaNI GTAC 1 cut(s) 188
SaqAI TTAA 1 cut(s) 171
SatI GCNGC 1 cut(s) 266
SetI ASST 2 cut(s) 79, 87
SgeI CNNG 8 cut(s) 32, 43, 47, 87, 92, 134, 189, 197
Sse9I AATT 1 cut(s) 106
SspI AATATT 1 cut(s) 203
SspMI CTAG 1 cut(s) 80
TaiI ACGT 1 cut(s) 79
TasI AATT 1 cut(s) 106
TatI WGTACW 1 cut(s) 187
Tru1I TTAA 1 cut(s) 171
Tru9I TTAA 1 cut(s) 171
TseI GCWGC 1 cut(s) 265
TspDTI ATGAA 1 cut(s) 205
TspGWI ACGGA 1 cut(s) 113
XbaI TCTAGA 1 cut(s) 79
XceI RCATGY 1 cut(s) 188
XspI CTAG 1 cut(s) 80
Zsp2I ATGCAT 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.