pycom16g13460

Major allergen Pru

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
N/A
Physical Location & Seq
Reverse (-)
9654980 .. 9655162
183 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 183 bp
ATGAGACTATGTTGGTGGCTTCCAGCCAGCAACTGTTCAATCATCAAGCGCACCTGCAACTACCACACCAAAGGTGATGTTGAAATCAAGGAAGAGCATCTCAAGGCTGGCAAAGAGAAAGCTTCCCACCTCTTGAAGTTGGTTGAGAACTACCTCTTGGAGCATCAGGATGCCTACAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

61

Amino Acids

7.07

Weight (kDa)

7.76

Isoelectric Point (pI)

26.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 62
Acc36I ACCTGC 1 cut(s) 62
AgsI TTSAA 3 cut(s) 39, 83, 136
AjuI GAANNNNNNNTTGG 2 cut(s) 140, 172
AluBI AGCT 1 cut(s) 122
AluI AGCT 1 cut(s) 122
AlwNI CAGNNNCTG 1 cut(s) 33
AspLEI GCGC 1 cut(s) 51
AsuHPI GGTGA 1 cut(s) 86
BfuAI ACCTGC 1 cut(s) 62
BmsI GCATC 3 cut(s) 106, 160, 172
BpuEI CTTGAG 1 cut(s) 86
BseGI GGATG 1 cut(s) 175
BspMI ACCTGC 1 cut(s) 62
BspQI GCTCTTC 1 cut(s) 87
Bst4CI ACNGT 1 cut(s) 35
Bst6I CTCTTC 1 cut(s) 87
BstC8I GCNNGC 2 cut(s) 28, 109
BstF5I GGATG 1 cut(s) 175
BstHHI GCGC 1 cut(s) 51
BtsCI GGATG 1 cut(s) 175
BveI ACCTGC 1 cut(s) 62
Cac8I GCNNGC 2 cut(s) 28, 109
CaiI CAGNNNCTG 1 cut(s) 33
CfoI GCGC 1 cut(s) 51
CviJI RGCY 4 cut(s) 19, 26, 107, 122
CviKI_1 RGCY 4 cut(s) 19, 26, 107, 122
Eam1104I CTCTTC 1 cut(s) 87
EarI CTCTTC 1 cut(s) 87
FaiI YATR 1 cut(s) 10
GlaI GCGC 1 cut(s) 50
HhaI GCGC 1 cut(s) 51
Hin6I GCGC 1 cut(s) 49
HinP1I GCGC 1 cut(s) 49
HindIII AAGCTT 1 cut(s) 120
HphI GGTGA 1 cut(s) 86
Hpy188III TCNNGA 2 cut(s) 133, 167
HpyCH4III ACNGT 1 cut(s) 35
HpyCH4V TGCA 1 cut(s) 57
HspAI GCGC 1 cut(s) 49
LguI GCTCTTC 1 cut(s) 87
LmnI GCTCC 1 cut(s) 160
LpnPI CCDG 5 cut(s) 36, 40, 67, 93, 152
LweI GCATC 3 cut(s) 106, 160, 172
MboII GAAGA 1 cut(s) 104
MnlI CCTC 2 cut(s) 140, 164
MslI CAYNNNNRTG 1 cut(s) 168
PaqCI CACCTGC 1 cut(s) 62
PciSI GCTCTTC 1 cut(s) 87
PstNI CAGNNNCTG 1 cut(s) 33
RseI CAYNNNNRTG 1 cut(s) 168
SapI GCTCTTC 1 cut(s) 87
SetI ASST 5 cut(s) 56, 76, 124, 132, 156
SfaNI GCATC 3 cut(s) 106, 160, 172
SmiMI CAYNNNNRTG 1 cut(s) 168
SmlI CTYRAG 1 cut(s) 101
SmoI CTYRAG 1 cut(s) 101
TaaI ACNGT 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.