pycom16g13660

Major allergen Pru

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
N/A
Physical Location & Seq
Forward (+)
9759229 .. 9759798
570 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 441 bp
ATGGGTGTCTTCACATACGAAACCAAATATGCCTCTGTCATCCCTCCTACTAGGTTGTACAATGCCCTTGTTCTTGATGCTGACAATCTCATTCCAAAAATTGCTCCACAAGCAATCAAAACTGCTGAAATTCTTGAAGATGGAGGTGTTGCAACGATGAAGAAGATTAGCTTTGATGAAGGAAGTGAATACAGCTATGCGAAGCACAAGTTGGATGGGATTGACAAATATAACTTTGTCTACAACTACAGTTTGACTGAAGGAGATGCTATTTTTGAGACAATTATACAGAATTTGACAACTTATACTATTAGTTCATGCGAGTTTCAAATTGTTTTCAAAATTGCCACCATTGGAAAGAACAAAATAATACTAACCAATTACAAATTTCATGTAAATAAGTATCTTTTTATACTTAAAAAATATATAATTTCATCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

147

Amino Acids

16.59

Weight (kDa)

7.73

Isoelectric Point (pI)

25.72

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Bet_v_1 PF00407 1 - 113 1.1e-09 Pathogenesis-related protein Bet v 1 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 240
AcsI RAATTY 3 cut(s) 129, 292, 386
AcuI CTGAAG 1 cut(s) 279
AfaI GTAC 1 cut(s) 59
AgsI TTSAA 3 cut(s) 137, 329, 340
AjuI GAANNNNNNNTTGG 2 cut(s) 194, 226
AluBI AGCT 2 cut(s) 171, 195
AluI AGCT 2 cut(s) 171, 195
Alw26I GTCTC 1 cut(s) 272
ApoI RAATTY 3 cut(s) 129, 292, 386
BccI CCATC 2 cut(s) 134, 209
BcoDI GTCTC 1 cut(s) 272
BfaI CTAG 1 cut(s) 51
BfmI CTRYAG 1 cut(s) 247
BmsI GCATC 2 cut(s) 67, 256
BseGI GGATG 2 cut(s) 39, 220
BsmAI GTCTC 1 cut(s) 272
Bsp1407I TGTACA 1 cut(s) 57
BsrGI TGTACA 1 cut(s) 57
Bst4CI ACNGT 1 cut(s) 251
BstAUI TGTACA 1 cut(s) 57
BstF5I GGATG 2 cut(s) 39, 220
BstMAI GTCTC 1 cut(s) 272
BstMWI GCNNNNNNNGC 1 cut(s) 110
BstSFI CTRYAG 1 cut(s) 247
BtsCI GGATG 2 cut(s) 39, 220
Csp6I GTAC 1 cut(s) 58
CviAII CATG 2 cut(s) 318, 392
CviJI RGCY 2 cut(s) 171, 195
CviKI_1 RGCY 2 cut(s) 171, 195
CviQI GTAC 1 cut(s) 58
Eco57I CTGAAG 1 cut(s) 279
FaeI CATG 2 cut(s) 321, 395
FalI AAGNNNNNCTT 2 cut(s) 155, 187
FatI CATG 2 cut(s) 317, 391
FblI GTMKAC 1 cut(s) 240
FokI GGATG 2 cut(s) 26, 227
FspBI CTAG 1 cut(s) 51
Hin1II CATG 2 cut(s) 321, 395
Hpy166II GTNNAC 1 cut(s) 241
Hpy188III TCNNGA 2 cut(s) 74, 134
Hpy8I GTNNAC 1 cut(s) 241
HpyAV CCTTC 2 cut(s) 173, 254
HpyCH4III ACNGT 1 cut(s) 251
HpyCH4V TGCA 1 cut(s) 152
HpyF10VI GCNNNNNNNGC 1 cut(s) 110
Hsp92II CATG 2 cut(s) 321, 395
LmnI GCTCC 1 cut(s) 109
LweI GCATC 2 cut(s) 67, 256
MaeI CTAG 1 cut(s) 51
MboII GAAGA 3 cut(s) 149, 172, 175
MluCI AATT 9 cut(s) 99, 129, 282, 292, 330, 342, 379, 386, 429
MmeI TCCRAC 1 cut(s) 192
MnlI CCTC 3 cut(s) 43, 54, 137
MseI TTAA 1 cut(s) 417
MwoI GCNNNNNNNGC 1 cut(s) 110
NlaIII CATG 2 cut(s) 321, 395
RsaI GTAC 1 cut(s) 59
RsaNI GTAC 1 cut(s) 58
SaqAI TTAA 1 cut(s) 417
SetI ASST 4 cut(s) 56, 148, 173, 197
SfaNI GCATC 2 cut(s) 67, 256
SfcI CTRYAG 1 cut(s) 247
SgeI CNNG 9 cut(s) 63, 80, 86, 122, 146, 220, 330, 334, 404
Sse9I AATT 9 cut(s) 99, 129, 282, 292, 330, 342, 379, 386, 429
SspMI CTAG 1 cut(s) 51
TaaI ACNGT 1 cut(s) 251
TasI AATT 9 cut(s) 99, 129, 282, 292, 330, 342, 379, 386, 429
TatI WGTACW 1 cut(s) 57
Tru1I TTAA 1 cut(s) 417
Tru9I TTAA 1 cut(s) 417
TspDTI ATGAA 5 cut(s) 173, 192, 306, 380, 423
XapI RAATTY 3 cut(s) 129, 292, 386
XmiI GTMKAC 1 cut(s) 240
XspI CTAG 1 cut(s) 51
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.