pycom16g14240

KH domain-containing protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Forward (+)
10267272 .. 10270672
3401 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 207 bp
ATGGCTATGGAAGAAGAGGTGGTATTCAAGTTGCTATGTCATGTTGATAAGGTTGGTAGTCTGATAGGGAAGGGTGGAAGCTCAGAGTACAACACTAGTGAGTACAGGCGCGTCGATTTGGATGCTCTTCTCAACATATCCACTGATGAGATCGTCAAGCTTTTCCCTGCCAATGCTCACAGAAGGACAGCACTCCTCGCATTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

69

Amino Acids

7.55

Weight (kDa)

5.55

Isoelectric Point (pI)

46.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0028520)

Species Orthologous Gene IDs
malus_domestica MD16G1169800.v1.1
pyrus_communis pycom16g14240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 111
AfaI GTAC 2 cut(s) 89, 104
AgsI TTSAA 1 cut(s) 28
AhlI ACTAGT 1 cut(s) 95
AluBI AGCT 2 cut(s) 81, 160
AluI AGCT 2 cut(s) 81, 160
AspLEI GCGC 1 cut(s) 111
BcgI CGANNNNNNTGC 2 cut(s) 104, 138
BcuI ACTAGT 1 cut(s) 95
BfaI CTAG 1 cut(s) 96
BmsI GCATC 1 cut(s) 112
BseGI GGATG 1 cut(s) 127
BseMII CTCAG 1 cut(s) 96
BseRI GAGGAG 1 cut(s) 185
Bsh1236I CGCG 1 cut(s) 111
Bsp143I GATC 1 cut(s) 150
BspCNI CTCAG 1 cut(s) 95
BspFNI CGCG 1 cut(s) 111
BspQI GCTCTTC 1 cut(s) 132
BssMI GATC 1 cut(s) 150
Bst6I CTCTTC 2 cut(s) 9, 132
BstDEI CTNAG 1 cut(s) 82
BstF5I GGATG 1 cut(s) 127
BstFNI CGCG 1 cut(s) 111
BstHHI GCGC 1 cut(s) 111
BstKTI GATC 1 cut(s) 153
BstMBI GATC 1 cut(s) 150
BstMWI GCNNNNNNNGC 1 cut(s) 197
BstUI CGCG 1 cut(s) 111
BtsCI GGATG 1 cut(s) 127
BtsIMutI CAGTG 1 cut(s) 141
CfoI GCGC 1 cut(s) 111
CseI GACGC 1 cut(s) 100
Csp6I GTAC 2 cut(s) 88, 103
CviAII CATG 1 cut(s) 41
CviJI RGCY 3 cut(s) 5, 81, 160
CviKI_1 RGCY 3 cut(s) 5, 81, 160
CviQI GTAC 2 cut(s) 88, 103
DdeI CTNAG 1 cut(s) 82
DpnI GATC 1 cut(s) 152
DpnII GATC 1 cut(s) 150
Eam1104I CTCTTC 2 cut(s) 9, 132
EarI CTCTTC 2 cut(s) 9, 132
FaeI CATG 1 cut(s) 44
FaiI YATR 4 cut(s) 8, 37, 42, 137
FatI CATG 1 cut(s) 40
FokI GGATG 1 cut(s) 134
FspBI CTAG 1 cut(s) 96
GlaI GCGC 1 cut(s) 110
HgaI GACGC 1 cut(s) 100
HhaI GCGC 1 cut(s) 111
Hin1II CATG 1 cut(s) 44
Hin6I GCGC 1 cut(s) 109
HinP1I GCGC 1 cut(s) 109
HindIII AAGCTT 1 cut(s) 158
Hpy188I TCNGA 2 cut(s) 63, 85
Hpy99I CGWCG 1 cut(s) 116
HpyAV CCTTC 2 cut(s) 64, 177
HpyF10VI GCNNNNNNNGC 1 cut(s) 197
HpyF3I CTNAG 1 cut(s) 82
Hsp92II CATG 1 cut(s) 44
HspAI GCGC 1 cut(s) 109
Kzo9I GATC 1 cut(s) 150
LguI GCTCTTC 1 cut(s) 132
LpnPI CCDG 2 cut(s) 91, 180
LweI GCATC 1 cut(s) 112
MaeI CTAG 1 cut(s) 96
MalI GATC 1 cut(s) 152
MboI GATC 1 cut(s) 150
MboII GAAGA 3 cut(s) 23, 26, 119
MnlI CCTC 2 cut(s) 10, 206
MvnI CGCG 1 cut(s) 111
MwoI GCNNNNNNNGC 1 cut(s) 197
NdeII GATC 1 cut(s) 150
NlaIII CATG 1 cut(s) 44
PciSI GCTCTTC 1 cut(s) 132
RsaI GTAC 2 cut(s) 89, 104
RsaNI GTAC 2 cut(s) 88, 103
SapI GCTCTTC 1 cut(s) 132
Sau3AI GATC 1 cut(s) 150
SetI ASST 4 cut(s) 21, 54, 83, 162
SfaNI GCATC 1 cut(s) 112
SgeI CNNG 7 cut(s) 40, 53, 108, 118, 122, 169, 179
SpeI ACTAGT 1 cut(s) 95
SspMI CTAG 1 cut(s) 96
TaqI TCGA 1 cut(s) 114
TatI WGTACW 2 cut(s) 87, 102
TscAI CASTG 1 cut(s) 148
TspRI CASTG 1 cut(s) 148
XspI CTAG 1 cut(s) 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.