pycom16g17010

ATP sulfurylase 1

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Forward (+)
13040101 .. 13040367
267 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 186 bp
ATGCTGTTTCCGACATTTTTTTTCTTTACTGTTATAATCAGCCATTCAAAGCGAACACTTGCAAGGAACAAAGAGAACCCTCCTGAAGGATTCATGTGCCCTAGTGGCTGGAAGGTGCTAGTTGACTACTATGAGAGTTTGGCTCCTGCAGACAGCGGTAAAGTCCCAGAAGCAGTTCCAGCCTAG

Protein Analysis

62

Amino Acids

6.84

Weight (kDa)

6.53

Isoelectric Point (pI)

57.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029443)

Species Orthologous Gene IDs
pyrus_communis pycom13g17490 pycom16g17010

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 35
AciI CCGC 1 cut(s) 156
AcuI CTGAAG 1 cut(s) 105
AfiI CCNNNNNNNGG 1 cut(s) 86
AgsI TTSAA 1 cut(s) 48
Asp700I GAANNNNTTC 1 cut(s) 174
BaeGI GKGCMC 1 cut(s) 101
BfaI CTAG 3 cut(s) 102, 119, 184
BfmI CTRYAG 1 cut(s) 147
BglI GCCNNNNNGGC 1 cut(s) 105
BmiI GGNNCC 1 cut(s) 144
BplI GAGNNNNNCTC 2 cut(s) 127, 159
Bsc4I CCNNNNNNNGG 1 cut(s) 86
BseLI CCNNNNNNNGG 1 cut(s) 86
BseSI GKGCMC 1 cut(s) 101
BslFI GGGAC 1 cut(s) 149
BslI CCNNNNNNNGG 1 cut(s) 86
BsmFI GGGAC 1 cut(s) 149
Bsp1286I GDGCHC 1 cut(s) 101
BspACI CCGC 1 cut(s) 156
BspLI GGNNCC 1 cut(s) 144
BspMAI CTGCAG 1 cut(s) 151
Bst4CI ACNGT 1 cut(s) 31
BstENI CCTNNNNNAGG 1 cut(s) 84
BstMWI GCNNNNNNNGC 2 cut(s) 105, 179
BstSFI CTRYAG 1 cut(s) 147
BstSLI GKGCMC 1 cut(s) 101
CviAII CATG 1 cut(s) 94
CviJI RGCY 4 cut(s) 42, 108, 143, 182
CviKI_1 RGCY 4 cut(s) 42, 108, 143, 182
Eco57I CTGAAG 1 cut(s) 105
EcoNI CCTNNNNNAGG 1 cut(s) 84
FaeI CATG 1 cut(s) 97
FaiI YATR 3 cut(s) 35, 95, 132
FaqI GGGAC 1 cut(s) 149
FatI CATG 1 cut(s) 93
FspBI CTAG 3 cut(s) 102, 119, 184
Hin1II CATG 1 cut(s) 97
HincII GTYRAC 1 cut(s) 124
HindII GTYRAC 1 cut(s) 124
HinfI GANTC 1 cut(s) 90
Hpy166II GTNNAC 1 cut(s) 124
Hpy188I TCNGA 1 cut(s) 12
Hpy188III TCNNGA 1 cut(s) 83
Hpy8I GTNNAC 1 cut(s) 124
HpyAV CCTTC 2 cut(s) 80, 106
HpyCH4III ACNGT 1 cut(s) 31
HpyCH4V TGCA 2 cut(s) 62, 149
HpyF10VI GCNNNNNNNGC 2 cut(s) 105, 179
Hsp92II CATG 1 cut(s) 97
LmnI GCTCC 1 cut(s) 148
LpnPI CCDG 4 cut(s) 94, 96, 159, 180
MaeI CTAG 3 cut(s) 102, 119, 184
MhlI GDGCHC 1 cut(s) 101
MmeI TCCRAC 1 cut(s) 35
MnlI CCTC 1 cut(s) 90
MroXI GAANNNNTTC 1 cut(s) 174
MspA1I CMGCKG 1 cut(s) 156
MwoI GCNNNNNNNGC 2 cut(s) 105, 179
NlaIII CATG 1 cut(s) 97
NlaIV GGNNCC 1 cut(s) 144
PdmI GAANNNNTTC 1 cut(s) 174
PfeI GAWTC 1 cut(s) 90
PsiI TTATAA 1 cut(s) 35
PspN4I GGNNCC 1 cut(s) 144
PstI CTGCAG 1 cut(s) 151
SduI GDGCHC 1 cut(s) 101
SetI ASST 1 cut(s) 117
SfcI CTRYAG 1 cut(s) 147
SgeI CNNG 9 cut(s) 71, 75, 95, 106, 114, 121, 131, 158, 179
SsiI CCGC 1 cut(s) 156
SspMI CTAG 3 cut(s) 102, 119, 184
TaaI ACNGT 1 cut(s) 31
TfiI GAWTC 1 cut(s) 90
TspDTI ATGAA 1 cut(s) 82
XagI CCTNNNNNAGG 1 cut(s) 84
XmnI GAANNNNTTC 1 cut(s) 174
XspI CTAG 3 cut(s) 102, 119, 184
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.