pycom16g17330

domain-containing protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
N/A
Physical Location & Seq
Forward (+)
13421909 .. 13422208
300 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 300 bp
ATGAAGATTGTTTCTGATTCAATTCTTTCTGTTACTAGTAGTTCATTTTCTAATTGGCTAGATATGAACTGGTTTGTAACGGGTCATCAAAGTGGGGCTGTTAAGGTATGGCAAATGGTTTATCCCACAAACCTCAAGAGTTTTCAACAGAAATCAATGAGCAATGAGATGGGTGGTTTAAATCTCAATGATAAGCACCATAGTACAAGTTTGGTGAAATGGGTATGTGTTTTGTTCTATGTAAATTGTTATGCGTTGAGAAAGATTACAGTCACGACACATTGTAATTCTTGTGATTAG

Protein Analysis

100

Amino Acids

11.26

Weight (kDa)

8.77

Isoelectric Point (pI)

28.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 205
AgsI TTSAA 2 cut(s) 21, 146
AhlI ACTAGT 1 cut(s) 35
AsuHPI GGTGA 1 cut(s) 226
BccI CCATC 1 cut(s) 163
BcuI ACTAGT 1 cut(s) 35
BfaI CTAG 2 cut(s) 36, 59
BpuEI CTTGAG 1 cut(s) 119
Bse1I ACTGG 1 cut(s) 74
Bse3DI GCAATG 1 cut(s) 169
BseMI GCAATG 1 cut(s) 169
BseNI ACTGG 1 cut(s) 74
BsrDI GCAATG 1 cut(s) 169
BsrI ACTGG 1 cut(s) 74
Bst4CI ACNGT 1 cut(s) 271
Csp6I GTAC 1 cut(s) 204
CviJI RGCY 2 cut(s) 58, 98
CviKI_1 RGCY 2 cut(s) 58, 98
CviQI GTAC 1 cut(s) 204
DraI TTTAAA 1 cut(s) 180
FaiI YATR 6 cut(s) 65, 109, 201, 226, 240, 252
FspBI CTAG 2 cut(s) 36, 59
HinfI GANTC 1 cut(s) 17
HphI GGTGA 1 cut(s) 226
Hpy188I TCNGA 1 cut(s) 16
Hpy188III TCNNGA 2 cut(s) 136, 274
HpyCH4III ACNGT 1 cut(s) 271
LpnPI CCDG 1 cut(s) 55
MaeI CTAG 2 cut(s) 36, 59
MaeIII GTNAC 3 cut(s) 31, 76, 271
MboII GAAGA 1 cut(s) 16
MluCI AATT 4 cut(s) 21, 52, 244, 286
MnlI CCTC 1 cut(s) 143
MseI TTAA 2 cut(s) 102, 179
MslI CAYNNNNRTG 1 cut(s) 90
NmuCI GTSAC 1 cut(s) 271
PfeI GAWTC 1 cut(s) 17
RsaI GTAC 1 cut(s) 205
RsaNI GTAC 1 cut(s) 204
RseI CAYNNNNRTG 1 cut(s) 90
SaqAI TTAA 2 cut(s) 102, 179
SetI ASST 2 cut(s) 108, 135
SgeI CNNG 7 cut(s) 48, 71, 82, 93, 148, 219, 286
SmiMI CAYNNNNRTG 1 cut(s) 90
SmlI CTYRAG 1 cut(s) 134
SmoI CTYRAG 1 cut(s) 134
SpeI ACTAGT 1 cut(s) 35
Sse9I AATT 4 cut(s) 21, 52, 244, 286
SspMI CTAG 2 cut(s) 36, 59
TaaI ACNGT 1 cut(s) 271
TasI AATT 4 cut(s) 21, 52, 244, 286
TatI WGTACW 1 cut(s) 203
TfiI GAWTC 1 cut(s) 17
Tru1I TTAA 2 cut(s) 102, 179
Tru9I TTAA 2 cut(s) 102, 179
TseFI GTSAC 1 cut(s) 271
Tsp45I GTSAC 1 cut(s) 271
TspDTI ATGAA 3 cut(s) 17, 33, 80
XspI CTAG 2 cut(s) 36, 59
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.