pycom16g21170

Apoptosis inhibitor

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
N/A
Physical Location & Seq
Forward (+)
19429951 .. 19430787
837 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 198 bp
ATGGCCCTTTTGAGGCAATATGGTAAAGCATTATTCAAGCACATTGGGAGTGTTGAGGAACCAAGCACATATGAGATCATTCGGGAGAAGGTATTTCCTATTAAAGCTGAAATTTTGATGCCTCAGGAGAAAATGGAAAGGCATATTACTGGTTCGATAAAAAAAGAGTTTGGAAGATGTGACTGGTGCAGACTTTAG

Protein Analysis

66

Amino Acids

7.68

Weight (kDa)

9.06

Isoelectric Point (pI)

65.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
API5 PF05918 9 - 58 2e-08 Apoptosis inhibitory protein 5 (API5)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 111
AfiI CCNNNNNNNGG 1 cut(s) 12
AgsI TTSAA 1 cut(s) 37
AluBI AGCT 1 cut(s) 107
AluI AGCT 1 cut(s) 107
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 1 cut(s) 111
AspS9I GGNCC 1 cut(s) 4
AxyI CCTNAGG 1 cut(s) 123
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 1 cut(s) 60
BmsI GCATC 1 cut(s) 108
Bsc4I CCNNNNNNNGG 1 cut(s) 12
Bse1I ACTGG 2 cut(s) 154, 188
Bse21I CCTNAGG 1 cut(s) 123
BseLI CCNNNNNNNGG 1 cut(s) 12
BseMII CTCAG 1 cut(s) 137
BseNI ACTGG 2 cut(s) 154, 188
BshFI GGCC 1 cut(s) 5
BslI CCNNNNNNNGG 1 cut(s) 12
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 1 cut(s) 75
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 136
BspLI GGNNCC 1 cut(s) 60
BsrI ACTGG 2 cut(s) 154, 188
BssMI GATC 1 cut(s) 75
BstDEI CTNAG 1 cut(s) 123
BstKTI GATC 1 cut(s) 78
BstMBI GATC 1 cut(s) 75
Bsu36I CCTNAGG 1 cut(s) 123
BsuRI GGCC 1 cut(s) 5
Cfr13I GGNCC 1 cut(s) 4
CviJI RGCY 2 cut(s) 5, 107
CviKI_1 RGCY 2 cut(s) 5, 107
DdeI CTNAG 1 cut(s) 123
DpnI GATC 1 cut(s) 77
DpnII GATC 1 cut(s) 75
Eco81I CCTNAGG 1 cut(s) 123
FaiI YATR 4 cut(s) 21, 70, 72, 144
FauNDI CATATG 1 cut(s) 70
HaeIII GGCC 1 cut(s) 5
Hpy188III TCNNGA 2 cut(s) 83, 125
HpyAV CCTTC 1 cut(s) 82
HpyCH4V TGCA 1 cut(s) 189
HpyF3I CTNAG 1 cut(s) 123
Kzo9I GATC 1 cut(s) 75
LpnPI CCDG 3 cut(s) 110, 135, 169
LweI GCATC 1 cut(s) 108
MaeIII GTNAC 1 cut(s) 179
MalI GATC 1 cut(s) 77
MboI GATC 1 cut(s) 75
MboII GAAGA 1 cut(s) 186
MluCI AATT 1 cut(s) 111
MnlI CCTC 3 cut(s) 6, 49, 132
MseI TTAA 1 cut(s) 102
NdeI CATATG 1 cut(s) 70
NdeII GATC 1 cut(s) 75
NlaIV GGNNCC 1 cut(s) 60
NmuCI GTSAC 1 cut(s) 179
PspN4I GGNNCC 1 cut(s) 60
PspPI GGNCC 1 cut(s) 4
SaqAI TTAA 1 cut(s) 102
Sau3AI GATC 1 cut(s) 75
Sau96I GGNCC 1 cut(s) 4
SetI ASST 2 cut(s) 93, 109
SfaNI GCATC 1 cut(s) 108
SgeI CNNG 5 cut(s) 49, 75, 95, 137, 162
Sse9I AATT 1 cut(s) 111
TaqI TCGA 1 cut(s) 155
TasI AATT 1 cut(s) 111
Tru1I TTAA 1 cut(s) 102
Tru9I TTAA 1 cut(s) 102
TseFI GTSAC 1 cut(s) 179
Tsp45I GTSAC 1 cut(s) 179
XapI RAATTY 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.