pycom16g24250

kDa ribonucleoprotein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
N/A
Physical Location & Seq
Reverse (-)
25507113 .. 25507364
252 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 252 bp
ATGACCAGGTTCATATATCTGGAAACTTTTTTTTCGCTTCCGAATTATTTGATACAGGAGATGTTGGGTAGGACTATCAGAATTGAGTTTACAAAGCAATTTAAGAAACCTTCTCCACTGCCCCCCAATCCCCAAGTTGGAGAGACACGCTATAAGCTTTACGTGTCTAATTTGGGATGGAAAGTAAGATCAAGCCATCTCAGAGATTTTGTCTCTGAAATTTTCATTTATGATGCACACACATATCTATAG

Protein Analysis

84

Amino Acids

9.98

Weight (kDa)

9.57

Isoelectric Point (pI)

44.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 219
AfiI CCNNNNNNNGG 1 cut(s) 137
AflIII ACRYGT 1 cut(s) 162
AjnI CCWGG 1 cut(s) 5
AluBI AGCT 1 cut(s) 157
AluI AGCT 1 cut(s) 157
Alw26I GTCTC 2 cut(s) 137, 217
ApoI RAATTY 1 cut(s) 219
BccI CCATC 2 cut(s) 171, 204
BciT130I CCWGG 1 cut(s) 7
BcoDI GTCTC 2 cut(s) 137, 217
BfmI CTRYAG 1 cut(s) 248
Bme1390I CCNGG 1 cut(s) 7
BmrFI CCNGG 1 cut(s) 7
BmsI GCATC 1 cut(s) 223
BsaAI YACGTR 1 cut(s) 163
Bsc4I CCNNNNNNNGG 1 cut(s) 137
BseBI CCWGG 1 cut(s) 7
BseGI GGATG 1 cut(s) 182
BseLI CCNNNNNNNGG 1 cut(s) 137
BseMII CTCAG 1 cut(s) 214
BslI CCNNNNNNNGG 1 cut(s) 137
BsmAI GTCTC 2 cut(s) 137, 217
Bsp143I GATC 1 cut(s) 188
BspCNI CTCAG 1 cut(s) 213
BssMI GATC 1 cut(s) 188
Bst2UI CCWGG 1 cut(s) 7
BstBAI YACGTR 1 cut(s) 163
BstDEI CTNAG 1 cut(s) 200
BstF5I GGATG 1 cut(s) 182
BstKTI GATC 1 cut(s) 191
BstMAI GTCTC 2 cut(s) 137, 217
BstMBI GATC 1 cut(s) 188
BstNI CCWGG 1 cut(s) 7
BstSCI CCNGG 1 cut(s) 5
BstSFI CTRYAG 1 cut(s) 248
BtsCI GGATG 1 cut(s) 182
BtsI GCAGTG 1 cut(s) 116
BtsIMutI CAGTG 1 cut(s) 116
CsiI ACCWGGT 1 cut(s) 5
CviJI RGCY 2 cut(s) 157, 195
CviKI_1 RGCY 2 cut(s) 157, 195
DdeI CTNAG 1 cut(s) 200
DpnI GATC 1 cut(s) 190
DpnII GATC 1 cut(s) 188
EcoRII CCWGG 1 cut(s) 5
FaiI YATR 6 cut(s) 14, 16, 153, 231, 244, 250
FokI GGATG 1 cut(s) 189
HindIII AAGCTT 1 cut(s) 155
Hpy166II GTNNAC 1 cut(s) 90
Hpy188I TCNGA 4 cut(s) 42, 80, 203, 217
Hpy188III TCNNGA 1 cut(s) 20
Hpy8I GTNNAC 1 cut(s) 90
HpyAV CCTTC 1 cut(s) 120
HpyCH4IV ACGT 1 cut(s) 162
HpyCH4V TGCA 1 cut(s) 236
HpyF3I CTNAG 1 cut(s) 200
HpySE526I ACGT 1 cut(s) 162
Kzo9I GATC 1 cut(s) 188
LpnPI CCDG 3 cut(s) 5, 19, 41
LweI GCATC 1 cut(s) 223
MabI ACCWGGT 1 cut(s) 5
MaeII ACGT 1 cut(s) 162
MalI GATC 1 cut(s) 190
MboI GATC 1 cut(s) 188
MluCI AATT 5 cut(s) 43, 81, 98, 169, 219
MmeI TCCRAC 1 cut(s) 118
MseI TTAA 1 cut(s) 102
MspR9I CCNGG 1 cut(s) 7
MvaI CCWGG 1 cut(s) 7
NdeII GATC 1 cut(s) 188
Ppu21I YACGTR 1 cut(s) 163
Psp6I CCWGG 1 cut(s) 5
PspGI CCWGG 1 cut(s) 5
SaqAI TTAA 1 cut(s) 102
Sau3AI GATC 1 cut(s) 188
ScrFI CCNGG 1 cut(s) 7
SetI ASST 4 cut(s) 11, 112, 159, 165
SexAI ACCWGGT 1 cut(s) 5
SfaNI GCATC 1 cut(s) 223
SfcI CTRYAG 1 cut(s) 248
SgeI CNNG 8 cut(s) 18, 19, 32, 68, 146, 159, 175, 204
Sse9I AATT 5 cut(s) 43, 81, 98, 169, 219
StyD4I CCNGG 1 cut(s) 5
TaiI ACGT 1 cut(s) 165
TasI AATT 5 cut(s) 43, 81, 98, 169, 219
Tru1I TTAA 1 cut(s) 102
Tru9I TTAA 1 cut(s) 102
TscAI CASTG 1 cut(s) 123
TspDTI ATGAA 1 cut(s) 214
TspRI CASTG 1 cut(s) 123
XapI RAATTY 1 cut(s) 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.