pycom17g01950

Beta-1,4-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
N/A
Physical Location & Seq
Forward (+)
1239656 .. 1240323
668 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 210 bp
ATGGCTGATGGGTATTACAGTTCGAAGAAGACTGACGATGTCTGCGACGACGTTTGTGGACAGGGATCGCAAGCGGCGTTGAGCATGTCTAGACTGCGGTGCATTTTGCGGGGCTTGGATTTGAAGATTTACATTTTCCTGTTTGCGGTTGTTCCATTAGGCGTATTTGGGATATATTTACATGGGCAGAATCGATCTCGTATTTCCTAA

Protein Analysis

70

Amino Acids

7.63

Weight (kDa)

8.55

Isoelectric Point (pI)

42.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 74, 97, 109, 146
AclWI GGATC 1 cut(s) 73
AfiI CCNNNNNNNGG 1 cut(s) 145
AgsI TTSAA 1 cut(s) 124
AlwI GGATC 1 cut(s) 73
AsuII TTCGAA 1 cut(s) 23
BbsI GAAGAC 1 cut(s) 35
BccI CCATC 1 cut(s) 2
BfaI CTAG 1 cut(s) 90
BisI GCNGC 1 cut(s) 75
BlsI GCNGC 1 cut(s) 76
BpiI GAAGAC 1 cut(s) 35
Bpu14I TTCGAA 1 cut(s) 23
Bsa29I ATCGAT 1 cut(s) 193
Bsc4I CCNNNNNNNGG 1 cut(s) 145
BseCI ATCGAT 1 cut(s) 193
BseLI CCNNNNNNNGG 1 cut(s) 145
BshVI ATCGAT 1 cut(s) 193
BslI CCNNNNNNNGG 1 cut(s) 145
Bsp119I TTCGAA 1 cut(s) 23
Bsp143I GATC 2 cut(s) 65, 194
BspACI CCGC 4 cut(s) 74, 97, 109, 146
BspDI ATCGAT 1 cut(s) 193
BspPI GGATC 1 cut(s) 73
BspT104I TTCGAA 1 cut(s) 23
BssMI GATC 2 cut(s) 65, 194
Bst4CI ACNGT 1 cut(s) 20
BstBI TTCGAA 1 cut(s) 23
BstC8I GCNNGC 1 cut(s) 72
BstKTI GATC 2 cut(s) 68, 197
BstMBI GATC 2 cut(s) 65, 194
BstNSI RCATGY 1 cut(s) 88
BstV2I GAAGAC 1 cut(s) 35
Bsu15I ATCGAT 1 cut(s) 193
BsuTUI ATCGAT 1 cut(s) 193
Cac8I GCNNGC 1 cut(s) 72
ClaI ATCGAT 1 cut(s) 193
CviAII CATG 2 cut(s) 85, 182
CviJI RGCY 2 cut(s) 5, 114
CviKI_1 RGCY 2 cut(s) 5, 114
DpnI GATC 2 cut(s) 67, 196
DpnII GATC 2 cut(s) 65, 194
FaeI CATG 2 cut(s) 88, 185
FaiI YATR 3 cut(s) 86, 175, 183
FatI CATG 2 cut(s) 84, 181
FauI CCCGC 1 cut(s) 102
Fnu4HI GCNGC 1 cut(s) 75
Fsp4HI GCNGC 1 cut(s) 75
FspBI CTAG 1 cut(s) 90
GluI GCNGC 1 cut(s) 75
Hin1II CATG 2 cut(s) 88, 185
HinfI GANTC 1 cut(s) 190
Hpy166II GTNNAC 1 cut(s) 59
Hpy188III TCNNGA 1 cut(s) 90
Hpy8I GTNNAC 1 cut(s) 59
Hpy99I CGWCG 2 cut(s) 50, 53
HpyCH4III ACNGT 1 cut(s) 20
HpyCH4IV ACGT 1 cut(s) 51
HpyCH4V TGCA 1 cut(s) 102
HpySE526I ACGT 1 cut(s) 51
Hsp92II CATG 2 cut(s) 88, 185
Kzo9I GATC 2 cut(s) 65, 194
LpnPI CCDG 2 cut(s) 47, 152
MaeI CTAG 1 cut(s) 90
MaeII ACGT 1 cut(s) 51
MalI GATC 2 cut(s) 67, 196
MboI GATC 2 cut(s) 65, 194
MboII GAAGA 3 cut(s) 37, 40, 136
NdeII GATC 2 cut(s) 65, 194
NlaIII CATG 2 cut(s) 88, 185
NspI RCATGY 1 cut(s) 88
NspV TTCGAA 1 cut(s) 23
PcsI WCGNNNNNNNCGW 2 cut(s) 42, 74
PfeI GAWTC 1 cut(s) 190
PflFI GACNNNGTC 1 cut(s) 38
PkrI GCNGC 1 cut(s) 76
PsyI GACNNNGTC 1 cut(s) 38
SatI GCNGC 1 cut(s) 75
Sau3AI GATC 2 cut(s) 65, 194
SetI ASST 1 cut(s) 54
SfuI TTCGAA 1 cut(s) 23
SgeI CNNG 8 cut(s) 74, 83, 97, 102, 122, 127, 151, 194
SsiI CCGC 4 cut(s) 74, 97, 109, 146
SspMI CTAG 1 cut(s) 90
TaaI ACNGT 1 cut(s) 20
TaiI ACGT 1 cut(s) 54
TaqI TCGA 2 cut(s) 23, 193
TauI GCSGC 1 cut(s) 77
TfiI GAWTC 1 cut(s) 190
Tth111I GACNNNGTC 1 cut(s) 38
XbaI TCTAGA 1 cut(s) 89
XceI RCATGY 1 cut(s) 88
XspI CTAG 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.