pycom17g01990
NAC Family

NAC domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
N/A
Physical Location & Seq
Reverse (-)
1253197 .. 1253563
367 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 291 bp
ATGGCACTTACTAGGTTTTCGAGCCCCCACAAAAGCTCGACAGGACAGCTTCGTTCGCTCCGAACCTCAGCCTCGGACACAGGTTTCGTCAACCTCCGGGGCAAAGGCTCGTCTGGTCCGAAGCTGGATTTTCCCGCTCACACAGACACTCTCCCCCTCTGCTTTAACTTAGTCCAGTGGAGAAAGGGTCGAGCTCTCTCTCTCTCTCCTCTTTCTCTCTCTAAAACTCCATATAAGTTGGGACGCGCTTCGTCGAACGCGGTCTCCTACTTCGAAGAAATGGCAAGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAM

Protein Analysis

97

Amino Acids

10.48

Weight (kDa)

10.69

Isoelectric Point (pI)

39.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 137
AccII CGCG 2 cut(s) 246, 260
AciI CCGC 2 cut(s) 135, 260
AloI GAACNNNNNNTCC 2 cut(s) 248, 280
AluBI AGCT 4 cut(s) 36, 49, 124, 194
AluI AGCT 4 cut(s) 36, 49, 124, 194
Alw21I GWGCWC 1 cut(s) 196
Alw26I GTCTC 1 cut(s) 268
ArsI GACNNNNNNTTYG 2 cut(s) 68, 100
AspLEI GCGC 1 cut(s) 248
AspS9I GGNCC 1 cut(s) 116
AsuC2I CCSGG 1 cut(s) 98
AsuII TTCGAA 1 cut(s) 273
AvaII GGWCC 1 cut(s) 116
BanII GRGCYC 2 cut(s) 26, 196
Bbv12I GWGCWC 1 cut(s) 196
BbvCI CCTCAGC 1 cut(s) 67
BcnI CCSGG 1 cut(s) 98
BcoDI GTCTC 1 cut(s) 268
BfaI CTAG 1 cut(s) 12
Bme1390I CCNGG 1 cut(s) 98
Bme18I GGWCC 1 cut(s) 116
BmgT120I GGNCC 1 cut(s) 116
BmrFI CCNGG 1 cut(s) 98
Bpu10I CCTNAGC 1 cut(s) 67
Bpu14I TTCGAA 1 cut(s) 273
BpuMI CCSGG 1 cut(s) 98
BsaI GGTCTC 1 cut(s) 268
BsaJI CCNNGG 2 cut(s) 72, 97
BsaXI ACNNNNNCTCC 4 cut(s) 172, 202, 248, 278
Bse1I ACTGG 1 cut(s) 175
BseDI CCNNGG 2 cut(s) 72, 97
BseMII CTCAG 1 cut(s) 81
BseNI ACTGG 1 cut(s) 175
BseRI GAGGAG 1 cut(s) 198
Bsh1236I CGCG 2 cut(s) 246, 260
BsiHKAI GWGCWC 1 cut(s) 196
BsiSI CCGG 1 cut(s) 97
BslFI GGGAC 1 cut(s) 255
BsmAI GTCTC 1 cut(s) 268
BsmFI GGGAC 1 cut(s) 255
Bso31I GGTCTC 1 cut(s) 268
Bsp119I TTCGAA 1 cut(s) 273
Bsp1286I GDGCHC 2 cut(s) 26, 196
BspACI CCGC 2 cut(s) 135, 260
BspCNI CTCAG 1 cut(s) 80
BspFNI CGCG 2 cut(s) 246, 260
BspT104I TTCGAA 1 cut(s) 273
BspTNI GGTCTC 1 cut(s) 268
BsrBI CCGCTC 1 cut(s) 137
BsrI ACTGG 1 cut(s) 175
BssECI CCNNGG 2 cut(s) 72, 97
BstBI TTCGAA 1 cut(s) 273
BstDEI CTNAG 2 cut(s) 67, 169
BstFNI CGCG 2 cut(s) 246, 260
BstHHI GCGC 1 cut(s) 248
BstMAI GTCTC 1 cut(s) 268
BstMWI GCNNNNNNNGC 1 cut(s) 55
BstSCI CCNGG 1 cut(s) 96
BstUI CGCG 2 cut(s) 246, 260
BtsIMutI CAGTG 1 cut(s) 182
CfoI GCGC 1 cut(s) 248
Cfr13I GGNCC 1 cut(s) 116
CseI GACGC 1 cut(s) 252
CviJI RGCY 7 cut(s) 24, 36, 49, 71, 108, 124, 194
CviKI_1 RGCY 7 cut(s) 24, 36, 49, 71, 108, 124, 194
DdeI CTNAG 2 cut(s) 67, 169
Ecl136II GAGCTC 1 cut(s) 194
Eco24I GRGCYC 2 cut(s) 26, 196
Eco31I GGTCTC 1 cut(s) 268
Eco47I GGWCC 1 cut(s) 116
Eco53kI GAGCTC 1 cut(s) 194
EcoICRI GAGCTC 1 cut(s) 194
EcoT38I GRGCYC 2 cut(s) 26, 196
FaiI YATR 2 cut(s) 232, 234
FaqI GGGAC 1 cut(s) 255
FauI CCCGC 1 cut(s) 142
FriOI GRGCYC 2 cut(s) 26, 196
FspBI CTAG 1 cut(s) 12
GlaI GCGC 1 cut(s) 247
HapII CCGG 1 cut(s) 97
HgaI GACGC 1 cut(s) 252
HhaI GCGC 1 cut(s) 248
Hin6I GCGC 1 cut(s) 246
HinP1I GCGC 1 cut(s) 246
HincII GTYRAC 1 cut(s) 91
HindII GTYRAC 1 cut(s) 91
HpaII CCGG 1 cut(s) 97
Hpy166II GTNNAC 1 cut(s) 91
Hpy188I TCNGA 3 cut(s) 62, 76, 120
Hpy8I GTNNAC 1 cut(s) 91
Hpy99I CGWCG 1 cut(s) 256
HpyF10VI GCNNNNNNNGC 1 cut(s) 55
HpyF3I CTNAG 2 cut(s) 67, 169
HspAI GCGC 1 cut(s) 246
LmnI GCTCC 1 cut(s) 63
LpnPI CCDG 6 cut(s) 27, 66, 99, 110, 110, 188
MaeI CTAG 1 cut(s) 12
MbiI CCGCTC 1 cut(s) 137
MboII GAAGA 1 cut(s) 287
MhlI GDGCHC 2 cut(s) 26, 196
MnlI CCTC 5 cut(s) 76, 82, 104, 167, 219
MseI TTAA 1 cut(s) 165
MspI CCGG 1 cut(s) 97
MspR9I CCNGG 1 cut(s) 98
MvnI CGCG 2 cut(s) 246, 260
MwoI GCNNNNNNNGC 1 cut(s) 55
NciI CCSGG 1 cut(s) 98
NspV TTCGAA 1 cut(s) 273
PcsI WCGNNNNNNNCGW 2 cut(s) 58, 116
Psp124BI GAGCTC 1 cut(s) 196
PspPI GGNCC 1 cut(s) 116
SacI GAGCTC 1 cut(s) 196
SaqAI TTAA 1 cut(s) 165
Sau96I GGNCC 1 cut(s) 116
ScrFI CCNGG 1 cut(s) 98
SduI GDGCHC 2 cut(s) 26, 196
SetI ASST 9 cut(s) 17, 38, 51, 68, 85, 96, 126, 196, 290
SfuI TTCGAA 1 cut(s) 273
SinI GGWCC 1 cut(s) 116
SsiI CCGC 2 cut(s) 135, 260
SspMI CTAG 1 cut(s) 12
SstI GAGCTC 1 cut(s) 196
StyD4I CCNGG 1 cut(s) 96
TaqI TCGA 5 cut(s) 20, 38, 190, 254, 273
Tru1I TTAA 1 cut(s) 165
Tru9I TTAA 1 cut(s) 165
TscAI CASTG 1 cut(s) 182
TspRI CASTG 1 cut(s) 182
VpaK11BI GGWCC 1 cut(s) 116
XspI CTAG 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.