pycom17g02350

protein ubiquitination

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
N/A
Physical Location & Seq
Forward (+)
1503389 .. 1503679
291 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 291 bp
ATGTTTGTTGTAGCATTCACAATACCTGATGGAAACAACCAAGTAACAGGATTTCCCATATTCTTAAACGGAAAGGTATTTATGGTTTTTATAGGTTCTGTTGCTATTTCACTCTGTTCTTCCGCAACTTCAGCTTTGATATTTTTGGGCATCCTTACATCGCGTTATGCTGAAGATGATTTCCTCAAATTCCTACCCACAAAGATGATACTAGGCCTTTTCTCACTCTTGATCTCCATCACCACCAATGGTTGCCTTTTCTTCTGCCCTATACATCATGTTTCAGGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

97

Amino Acids

10.4

Weight (kDa)

6.69

Isoelectric Point (pI)

19.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PGG PF13962 1 - 83 6e-09 Domain of unknown function
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 163
AciI CCGC 1 cut(s) 123
AcsI RAATTY 1 cut(s) 188
AcuI CTGAAG 2 cut(s) 114, 192
AluBI AGCT 1 cut(s) 134
AluI AGCT 1 cut(s) 134
AoxI GGCC 1 cut(s) 214
ApoI RAATTY 1 cut(s) 188
AsuHPI GGTGA 1 cut(s) 232
BccI CCATC 2 cut(s) 23, 245
BfaI CTAG 1 cut(s) 212
BmsI GCATC 1 cut(s) 159
BsaBI GATNNNNATC 1 cut(s) 236
Bse8I GATNNNNATC 1 cut(s) 236
BseGI GGATG 1 cut(s) 150
BseJI GATNNNNATC 1 cut(s) 236
Bsh1236I CGCG 1 cut(s) 163
BshFI GGCC 1 cut(s) 216
BsmI GAATGC 1 cut(s) 14
BsnI GGCC 1 cut(s) 216
Bsp143I GATC 1 cut(s) 231
BspACI CCGC 1 cut(s) 123
BspANI GGCC 1 cut(s) 216
BspFNI CGCG 1 cut(s) 163
BssMI GATC 1 cut(s) 231
BstF5I GGATG 1 cut(s) 150
BstFNI CGCG 1 cut(s) 163
BstKTI GATC 1 cut(s) 234
BstMBI GATC 1 cut(s) 231
BstMWI GCNNNNNNNGC 1 cut(s) 131
BstUI CGCG 1 cut(s) 163
BsuRI GGCC 1 cut(s) 216
BtgZI GCGATG 1 cut(s) 144
BtsCI GGATG 1 cut(s) 150
CviAII CATG 1 cut(s) 278
CviJI RGCY 2 cut(s) 134, 216
CviKI_1 RGCY 2 cut(s) 134, 216
DpnI GATC 1 cut(s) 233
DpnII GATC 1 cut(s) 231
Eco147I AGGCCT 1 cut(s) 216
Eco57I CTGAAG 2 cut(s) 114, 192
FaeI CATG 1 cut(s) 281
FaiI YATR 6 cut(s) 59, 83, 92, 168, 272, 279
FatI CATG 1 cut(s) 277
FokI GGATG 1 cut(s) 137
FspBI CTAG 1 cut(s) 212
HaeIII GGCC 1 cut(s) 216
Hin1II CATG 1 cut(s) 281
HphI GGTGA 1 cut(s) 232
Hpy188III TCNNGA 2 cut(s) 229, 285
HpyF10VI GCNNNNNNNGC 1 cut(s) 131
Hsp92II CATG 1 cut(s) 281
Kzo9I GATC 1 cut(s) 231
LpnPI CCDG 3 cut(s) 33, 39, 270
LweI GCATC 1 cut(s) 159
MaeI CTAG 1 cut(s) 212
MaeIII GTNAC 1 cut(s) 43
MalI GATC 1 cut(s) 233
MboI GATC 1 cut(s) 231
MboII GAAGA 3 cut(s) 111, 185, 253
MluCI AATT 1 cut(s) 188
MnlI CCTC 1 cut(s) 194
MseI TTAA 1 cut(s) 65
MslI CAYNNNNRTG 1 cut(s) 203
Mva1269I GAATGC 1 cut(s) 14
MvnI CGCG 1 cut(s) 163
MwoI GCNNNNNNNGC 1 cut(s) 131
NdeII GATC 1 cut(s) 231
NlaIII CATG 1 cut(s) 281
PceI AGGCCT 1 cut(s) 216
PctI GAATGC 1 cut(s) 14
RseI CAYNNNNRTG 1 cut(s) 203
SaqAI TTAA 1 cut(s) 65
Sau3AI GATC 1 cut(s) 231
SetI ASST 4 cut(s) 28, 78, 97, 136
SfaNI GCATC 1 cut(s) 159
SgeI CNNG 6 cut(s) 38, 53, 60, 174, 224, 241
SmiMI CAYNNNNRTG 1 cut(s) 203
Sse9I AATT 1 cut(s) 188
SseBI AGGCCT 1 cut(s) 216
SsiI CCGC 1 cut(s) 123
SspMI CTAG 1 cut(s) 212
StuI AGGCCT 1 cut(s) 216
TasI AATT 1 cut(s) 188
Tru1I TTAA 1 cut(s) 65
Tru9I TTAA 1 cut(s) 65
TspGWI ACGGA 1 cut(s) 84
XapI RAATTY 1 cut(s) 188
XspI CTAG 1 cut(s) 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.