pycom17g02520

Plant mobile domain

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
N/A
Physical Location & Seq
Reverse (-)
1656441 .. 1656674
234 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 234 bp
ATGAAGAAGGCAAGAAAAAGTAAGGAGGATGAAAGATCATCTAAGAAAAGTAATGCTAATGAGAAAAATATTCCGGTACATCCCCCTGCATCTGTGCAGAAGCGAAAGGCTGCCTCCTCTAATGAATCAGAGGTGGTTAATGATTCCGTAGAGGATAAACCATCTTTTGATGGTGTTGTAGACGACATCCAAGCTACAGACGATACAAATGTTGGGGAACTTGCATCCAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

8.37

Weight (kDa)

5.79

Isoelectric Point (pI)

43.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 180
AfaI GTAC 1 cut(s) 78
AluBI AGCT 1 cut(s) 194
AluI AGCT 1 cut(s) 194
ApeKI GCWGC 1 cut(s) 110
BaeI ACNNNNGTAYC 2 cut(s) 195, 228
BbvI GCAGC 1 cut(s) 97
BccI CCATC 2 cut(s) 164, 169
BfmI CTRYAG 1 cut(s) 195
BisI GCNGC 1 cut(s) 111
BlsI GCNGC 1 cut(s) 112
BmsI GCATC 1 cut(s) 98
BsaWI WCCGGW 1 cut(s) 73
BseGI GGATG 4 cut(s) 34, 79, 186, 224
BseRI GAGGAG 1 cut(s) 106
BseXI GCAGC 1 cut(s) 97
BsgI GTGCAG 1 cut(s) 116
BsiSI CCGG 1 cut(s) 74
Bsp143I GATC 1 cut(s) 35
BssMI GATC 1 cut(s) 35
BstDEI CTNAG 1 cut(s) 42
BstF5I GGATG 4 cut(s) 34, 79, 186, 224
BstKTI GATC 1 cut(s) 38
BstMBI GATC 1 cut(s) 35
BstSFI CTRYAG 1 cut(s) 195
BstV1I GCAGC 1 cut(s) 97
BtsCI GGATG 4 cut(s) 34, 79, 186, 224
Csp6I GTAC 1 cut(s) 77
CviJI RGCY 2 cut(s) 110, 194
CviKI_1 RGCY 2 cut(s) 110, 194
CviQI GTAC 1 cut(s) 77
DdeI CTNAG 1 cut(s) 42
DpnI GATC 1 cut(s) 37
DpnII GATC 1 cut(s) 35
FblI GTMKAC 1 cut(s) 180
Fnu4HI GCNGC 1 cut(s) 111
FokI GGATG 4 cut(s) 41, 66, 173, 211
Fsp4HI GCNGC 1 cut(s) 111
GluI GCNGC 1 cut(s) 111
HapII CCGG 1 cut(s) 74
HinfI GANTC 2 cut(s) 125, 143
HpaII CCGG 1 cut(s) 74
Hpy166II GTNNAC 1 cut(s) 181
Hpy188I TCNGA 1 cut(s) 130
Hpy8I GTNNAC 1 cut(s) 181
HpyCH4V TGCA 3 cut(s) 89, 97, 224
HpyF3I CTNAG 1 cut(s) 42
Kzo9I GATC 1 cut(s) 35
LpnPI CCDG 2 cut(s) 87, 99
Lsp1109I GCAGC 1 cut(s) 97
LweI GCATC 1 cut(s) 98
MalI GATC 1 cut(s) 37
MboI GATC 1 cut(s) 35
MboII GAAGA 1 cut(s) 16
MnlI CCTC 5 cut(s) 19, 124, 124, 127, 145
MseI TTAA 1 cut(s) 138
MspI CCGG 1 cut(s) 74
NdeII GATC 1 cut(s) 35
PfeI GAWTC 2 cut(s) 125, 143
PkrI GCNGC 1 cut(s) 112
RsaI GTAC 1 cut(s) 78
RsaNI GTAC 1 cut(s) 77
SaqAI TTAA 1 cut(s) 138
SatI GCNGC 1 cut(s) 111
Sau3AI GATC 1 cut(s) 35
SetI ASST 2 cut(s) 135, 196
SfaNI GCATC 1 cut(s) 98
SfcI CTRYAG 1 cut(s) 195
SgeI CNNG 4 cut(s) 24, 86, 98, 203
SspI AATATT 1 cut(s) 70
TfiI GAWTC 2 cut(s) 125, 143
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
TseI GCWGC 1 cut(s) 110
TspDTI ATGAA 3 cut(s) 17, 45, 138
TspGWI ACGGA 1 cut(s) 136
XmiI GTMKAC 1 cut(s) 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.