pycom17g05740

40S ribosomal protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
N/A
Physical Location & Seq
Reverse (-)
4063571 .. 4064672
1102 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 213 bp
ATGGCGACTGCGAAAACTGTGAAGGATGTTTCCCCTCACGAATTTGTCAAGGCTTACGCCGCCCATCTGAAGCGATCTGGAAAGGTTGAGCTTCCTCCATGGACTGATATCGTTAAGACTGGAAGATTCAAGGAGTTGGCTCCTTATGATCCTGACTGGTACTATGTCAGAGCTGCCTCCATGGCAAGGAAGATCTATCAACTCAAACCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

8.07

Weight (kDa)

9.74

Isoelectric Point (pI)

29.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S19e PF01090 6 - 67 6.7e-28 Ribosomal protein S19e
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 60
AclWI GGATC 1 cut(s) 143
AcsI RAATTY 1 cut(s) 41
AcuI CTGAAG 1 cut(s) 89
AfaI GTAC 1 cut(s) 161
AfiI CCNNNNNNNGG 1 cut(s) 186
AgsI TTSAA 1 cut(s) 130
AluBI AGCT 2 cut(s) 91, 173
AluI AGCT 2 cut(s) 91, 173
AlwI GGATC 1 cut(s) 143
ApeKI GCWGC 1 cut(s) 173
ApoI RAATTY 1 cut(s) 41
BbvI GCAGC 1 cut(s) 160
BccI CCATC 1 cut(s) 72
BglI GCCNNNNNGGC 1 cut(s) 182
BglII AGATCT 1 cut(s) 192
BisI GCNGC 2 cut(s) 60, 174
BlsI GCNGC 2 cut(s) 61, 175
BmiI GGNNCC 1 cut(s) 141
BsaJI CCNNGG 2 cut(s) 98, 180
Bsc4I CCNNNNNNNGG 1 cut(s) 186
Bse1I ACTGG 2 cut(s) 124, 161
BseDI CCNNGG 2 cut(s) 98, 180
BseGI GGATG 1 cut(s) 31
BseLI CCNNNNNNNGG 1 cut(s) 186
BseNI ACTGG 2 cut(s) 124, 161
BseXI GCAGC 1 cut(s) 160
BslI CCNNNNNNNGG 1 cut(s) 186
Bsp143I GATC 3 cut(s) 74, 148, 192
Bsp19I CCATGG 2 cut(s) 98, 180
BspACI CCGC 1 cut(s) 60
BspLI GGNNCC 1 cut(s) 141
BspPI GGATC 1 cut(s) 143
BsrI ACTGG 2 cut(s) 124, 161
BssECI CCNNGG 2 cut(s) 98, 180
BssMI GATC 3 cut(s) 74, 148, 192
BssT1I CCWWGG 2 cut(s) 98, 180
Bst4CI ACNGT 1 cut(s) 19
BstDSI CCRYGG 2 cut(s) 98, 180
BstF5I GGATG 1 cut(s) 31
BstKTI GATC 3 cut(s) 77, 151, 195
BstMBI GATC 3 cut(s) 74, 148, 192
BstMWI GCNNNNNNNGC 2 cut(s) 59, 182
BstV1I GCAGC 1 cut(s) 160
BstX2I RGATCY 1 cut(s) 192
BstYI RGATCY 1 cut(s) 192
BtgI CCRYGG 2 cut(s) 98, 180
BtsCI GGATG 1 cut(s) 31
Csp6I GTAC 1 cut(s) 160
CviAII CATG 2 cut(s) 99, 181
CviJI RGCY 4 cut(s) 53, 91, 140, 173
CviKI_1 RGCY 4 cut(s) 53, 91, 140, 173
CviQI GTAC 1 cut(s) 160
DpnI GATC 3 cut(s) 76, 150, 194
DpnII GATC 3 cut(s) 74, 148, 192
Eco130I CCWWGG 2 cut(s) 98, 180
Eco32I GATATC 1 cut(s) 109
Eco57I CTGAAG 1 cut(s) 89
EcoRV GATATC 1 cut(s) 109
EcoT14I CCWWGG 2 cut(s) 98, 180
ErhI CCWWGG 2 cut(s) 98, 180
FaeI CATG 2 cut(s) 102, 184
FaiI YATR 4 cut(s) 100, 147, 165, 182
FatI CATG 2 cut(s) 98, 180
Fnu4HI GCNGC 2 cut(s) 60, 174
FokI GGATG 1 cut(s) 38
Fsp4HI GCNGC 2 cut(s) 60, 174
GluI GCNGC 2 cut(s) 60, 174
Hin1II CATG 2 cut(s) 102, 184
HinfI GANTC 1 cut(s) 126
Hpy188I TCNGA 2 cut(s) 69, 170
Hpy188III TCNNGA 3 cut(s) 38, 78, 152
HpyAV CCTTC 1 cut(s) 16
HpyCH4III ACNGT 1 cut(s) 19
HpyF10VI GCNNNNNNNGC 2 cut(s) 59, 182
Hsp92II CATG 2 cut(s) 102, 184
Kzo9I GATC 3 cut(s) 74, 148, 192
LmnI GCTCC 1 cut(s) 145
LpnPI CCDG 4 cut(s) 63, 105, 142, 165
Lsp1109I GCAGC 1 cut(s) 160
MalI GATC 3 cut(s) 76, 150, 194
MboI GATC 3 cut(s) 74, 148, 192
MboII GAAGA 2 cut(s) 135, 202
MflI RGATCY 1 cut(s) 192
MluCI AATT 1 cut(s) 41
MnlI CCTC 3 cut(s) 45, 105, 187
MseI TTAA 1 cut(s) 114
MwoI GCNNNNNNNGC 2 cut(s) 59, 182
NcoI CCATGG 2 cut(s) 98, 180
NdeII GATC 3 cut(s) 74, 148, 192
NlaIII CATG 2 cut(s) 102, 184
NlaIV GGNNCC 1 cut(s) 141
PfeI GAWTC 1 cut(s) 126
PkrI GCNGC 2 cut(s) 61, 175
PspN4I GGNNCC 1 cut(s) 141
PsuI RGATCY 1 cut(s) 192
RsaI GTAC 1 cut(s) 161
RsaNI GTAC 1 cut(s) 160
SaqAI TTAA 1 cut(s) 114
SatI GCNGC 2 cut(s) 60, 174
Sau3AI GATC 3 cut(s) 74, 148, 192
SetI ASST 4 cut(s) 87, 93, 175, 211
Sse9I AATT 1 cut(s) 41
SsiI CCGC 1 cut(s) 60
StyI CCWWGG 2 cut(s) 98, 180
TaaI ACNGT 1 cut(s) 19
TasI AATT 1 cut(s) 41
TauI GCSGC 1 cut(s) 62
TfiI GAWTC 1 cut(s) 126
Tru1I TTAA 1 cut(s) 114
Tru9I TTAA 1 cut(s) 114
TseI GCWGC 1 cut(s) 173
XapI RAATTY 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.