pycom17g07110

Protein translation factor SUI1 homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
N/A
Physical Location & Seq
Reverse (-)
5128108 .. 5128877
770 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 453 bp
ATGCTTGTGTGGATGCGCACTGGTTTTTATCCATGTCAATGCCTAAGTCAACAAGTACTATTCAACAGCACAACTAGCCTGATCCACCAAAGAAACCGAACCAAACTAACCCAAAATGGTTGTTTTGAAAAACTAAATATATGGATTGATCCGTTTGCTGAGGCAAATGCTGAGGATTCAGGTGCTGGGACAAAAGATTATGTACACATTCGTGTTCAGCAAAGAAACGGTAGGAAAAGCCTGACAACCGTGCAGGGACTGAAGAAGGAATTTAGCTACAACAAAATCCTCAAGGACCTTAAGAAGGAATTTTGTTGCAATGGTACAGTCGTCCAGGATCCAGAGCAAGGGCAGGTCATTCAACTTCAAGGTGATCAACGAAAGAACGTCTCTGCCTTCCTCGTCCAGGCTGGCATTGTGAAGAAGGACCACATCAAGATTCACGGTTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03013 map03013
Pfam Domains
Protein Families
SUI1

Protein Analysis

151

Amino Acids

17.13

Weight (kDa)

9.4

Isoelectric Point (pI)

29.01

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SUI1 PF01253 65 - 139 7.9e-27 Translation initiation factor SUI1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 17
Acc36I ACCTGC 1 cut(s) 343
AclWI GGATC 4 cut(s) 76, 143, 332, 345
AcsI RAATTY 2 cut(s) 269, 308
AcuI CTGAAG 1 cut(s) 281
AfaI GTAC 3 cut(s) 57, 204, 325
AfiI CCNNNNNNNGG 3 cut(s) 304, 347, 406
AflII CTTAAG 1 cut(s) 299
AgsI TTSAA 4 cut(s) 64, 128, 362, 368
AjnI CCWGG 2 cut(s) 333, 405
AleI CACNNNNGTG 1 cut(s) 210
AluBI AGCT 1 cut(s) 276
AluI AGCT 1 cut(s) 276
Alw26I GTCTC 1 cut(s) 394
AlwI GGATC 4 cut(s) 76, 143, 332, 345
AlwNI CAGNNNCTG 2 cut(s) 185, 259
ApoI RAATTY 2 cut(s) 269, 308
AspLEI GCGC 1 cut(s) 18
AspS9I GGNCC 2 cut(s) 295, 427
AsuHPI GGTGA 1 cut(s) 383
AvaII GGWCC 2 cut(s) 295, 427
BaeI ACNNNNGTAYC 2 cut(s) 315, 348
BamHI GGATCC 1 cut(s) 337
BbvCI CCTCAGC 2 cut(s) 159, 171
BciT130I CCWGG 2 cut(s) 335, 407
BclI TGATCA 1 cut(s) 373
BcoDI GTCTC 1 cut(s) 394
BfaI CTAG 1 cut(s) 75
BfrI CTTAAG 1 cut(s) 299
BfuAI ACCTGC 1 cut(s) 343
BmcAI AGTACT 1 cut(s) 57
Bme1390I CCNGG 2 cut(s) 335, 407
Bme18I GGWCC 2 cut(s) 295, 427
BmgT120I GGNCC 2 cut(s) 295, 427
BmiI GGNNCC 1 cut(s) 339
BmrFI CCNGG 2 cut(s) 335, 407
BmsI GCATC 1 cut(s) 3
Bpu10I CCTNAGC 2 cut(s) 159, 171
BpuEI CTTGAG 1 cut(s) 275
Bsc4I CCNNNNNNNGG 3 cut(s) 304, 347, 406
Bse1I ACTGG 1 cut(s) 25
Bse3DI GCAATG 1 cut(s) 325
BseBI CCWGG 2 cut(s) 335, 407
BseGI GGATG 1 cut(s) 18
BseLI CCNNNNNNNGG 3 cut(s) 304, 347, 406
BseMI GCAATG 1 cut(s) 325
BseMII CTCAG 2 cut(s) 150, 162
BseNI ACTGG 1 cut(s) 25
BseYI CCCAGC 1 cut(s) 185
BsgI GTGCAG 1 cut(s) 272
BslFI GGGAC 2 cut(s) 202, 270
BslI CCNNNNNNNGG 3 cut(s) 304, 347, 406
BsmAI GTCTC 1 cut(s) 394
BsmBI CGTCTC 1 cut(s) 394
BsmFI GGGAC 2 cut(s) 202, 270
Bsp1407I TGTACA 1 cut(s) 202
Bsp143I GATC 4 cut(s) 81, 148, 337, 373
BspCNI CTCAG 2 cut(s) 151, 163
BspLI GGNNCC 1 cut(s) 339
BspMI ACCTGC 1 cut(s) 343
BspPI GGATC 4 cut(s) 76, 143, 332, 345
BspTI CTTAAG 1 cut(s) 299
BsrDI GCAATG 1 cut(s) 325
BsrGI TGTACA 1 cut(s) 202
BsrI ACTGG 1 cut(s) 25
BssMI GATC 4 cut(s) 81, 148, 337, 373
Bst2UI CCWGG 2 cut(s) 335, 407
Bst4CI ACNGT 4 cut(s) 230, 250, 328, 446
BstAFI CTTAAG 1 cut(s) 299
BstAUI TGTACA 1 cut(s) 202
BstC8I GCNNGC 1 cut(s) 412
BstDEI CTNAG 3 cut(s) 44, 159, 171
BstENI CCTNNNNNAGG 2 cut(s) 302, 404
BstF5I GGATG 1 cut(s) 18
BstHHI GCGC 1 cut(s) 18
BstKTI GATC 4 cut(s) 84, 151, 340, 376
BstMAI GTCTC 1 cut(s) 394
BstMBI GATC 4 cut(s) 81, 148, 337, 373
BstMWI GCNNNNNNNGC 1 cut(s) 75
BstNI CCWGG 2 cut(s) 335, 407
BstSCI CCNGG 2 cut(s) 333, 405
BstX2I RGATCY 1 cut(s) 337
BstYI RGATCY 1 cut(s) 337
BtsCI GGATG 1 cut(s) 18
BtsIMutI CAGTG 1 cut(s) 18
BveI ACCTGC 1 cut(s) 343
Cac8I GCNNGC 1 cut(s) 412
CaiI CAGNNNCTG 2 cut(s) 185, 259
CfoI GCGC 1 cut(s) 18
Cfr13I GGNCC 2 cut(s) 295, 427
Csp6I GTAC 3 cut(s) 56, 203, 324
CviAII CATG 1 cut(s) 33
CviJI RGCY 4 cut(s) 78, 240, 276, 410
CviKI_1 RGCY 4 cut(s) 78, 240, 276, 410
CviQI GTAC 3 cut(s) 56, 203, 324
DdeI CTNAG 3 cut(s) 44, 159, 171
DpnI GATC 4 cut(s) 83, 150, 339, 375
DpnII GATC 4 cut(s) 81, 148, 337, 373
Eco47I GGWCC 2 cut(s) 295, 427
Eco57I CTGAAG 1 cut(s) 281
EcoNI CCTNNNNNAGG 2 cut(s) 302, 404
EcoO109I RGGNCCY 1 cut(s) 295
EcoRII CCWGG 2 cut(s) 333, 405
Esp3I CGTCTC 1 cut(s) 394
FaeI CATG 1 cut(s) 36
FaiI YATR 4 cut(s) 34, 140, 142, 201
FaqI GGGAC 2 cut(s) 202, 270
FatI CATG 1 cut(s) 32
FbaI TGATCA 1 cut(s) 373
FokI GGATG 1 cut(s) 25
FspAI RTGCGCAY 1 cut(s) 17
FspBI CTAG 1 cut(s) 75
FspI TGCGCA 1 cut(s) 17
GlaI GCGC 1 cut(s) 17
GsaI CCCAGC 1 cut(s) 189
HhaI GCGC 1 cut(s) 18
Hin1II CATG 1 cut(s) 36
Hin6I GCGC 1 cut(s) 16
HinP1I GCGC 1 cut(s) 16
HincII GTYRAC 1 cut(s) 50
HindII GTYRAC 1 cut(s) 50
HinfI GANTC 2 cut(s) 176, 439
HphI GGTGA 1 cut(s) 383
Hpy166II GTNNAC 2 cut(s) 50, 205
Hpy188I TCNGA 1 cut(s) 452
Hpy188III TCNNGA 2 cut(s) 341, 436
Hpy8I GTNNAC 2 cut(s) 50, 205
HpyAV CCTTC 4 cut(s) 259, 298, 406, 418
HpyCH4III ACNGT 4 cut(s) 230, 250, 328, 446
HpyCH4IV ACGT 1 cut(s) 387
HpyCH4V TGCA 2 cut(s) 253, 318
HpyF10VI GCNNNNNNNGC 1 cut(s) 75
HpyF3I CTNAG 3 cut(s) 44, 159, 171
HpySE526I ACGT 1 cut(s) 387
Hsp92II CATG 1 cut(s) 36
HspAI GCGC 1 cut(s) 16
Ksp22I TGATCA 1 cut(s) 373
Kzo9I GATC 4 cut(s) 81, 148, 337, 373
LweI GCATC 1 cut(s) 3
MaeI CTAG 1 cut(s) 75
MaeII ACGT 1 cut(s) 387
MalI GATC 4 cut(s) 83, 150, 339, 375
MboI GATC 4 cut(s) 81, 148, 337, 373
MboII GAAGA 2 cut(s) 274, 433
MflI RGATCY 1 cut(s) 337
MluCI AATT 2 cut(s) 269, 308
MnlI CCTC 4 cut(s) 154, 166, 299, 410
MseI TTAA 1 cut(s) 300
MslI CAYNNNNRTG 2 cut(s) 37, 210
MspCI CTTAAG 1 cut(s) 299
MspR9I CCNGG 2 cut(s) 335, 407
MvaI CCWGG 2 cut(s) 335, 407
MwoI GCNNNNNNNGC 1 cut(s) 75
NdeII GATC 4 cut(s) 81, 148, 337, 373
NlaIII CATG 1 cut(s) 36
NlaIV GGNNCC 1 cut(s) 339
NsbI TGCGCA 1 cut(s) 17
OliI CACNNNNGTG 1 cut(s) 210
PfeI GAWTC 2 cut(s) 176, 439
PfoI TCCNGGA 1 cut(s) 333
PpuMI RGGWCCY 1 cut(s) 295
Psp5II RGGWCCY 1 cut(s) 295
Psp6I CCWGG 2 cut(s) 333, 405
PspFI CCCAGC 1 cut(s) 185
PspGI CCWGG 2 cut(s) 333, 405
PspN4I GGNNCC 1 cut(s) 339
PspPI GGNCC 2 cut(s) 295, 427
PspPPI RGGWCCY 1 cut(s) 295
PstNI CAGNNNCTG 2 cut(s) 185, 259
PsuI RGATCY 1 cut(s) 337
RsaI GTAC 3 cut(s) 57, 204, 325
RsaNI GTAC 3 cut(s) 56, 203, 324
RseI CAYNNNNRTG 2 cut(s) 37, 210
SaqAI TTAA 1 cut(s) 300
Sau3AI GATC 4 cut(s) 81, 148, 337, 373
Sau96I GGNCC 2 cut(s) 295, 427
ScaI AGTACT 1 cut(s) 57
ScrFI CCNGG 2 cut(s) 335, 407
SetI ASST 6 cut(s) 184, 278, 300, 357, 373, 390
SfaNI GCATC 1 cut(s) 3
SinI GGWCC 2 cut(s) 295, 427
SmiMI CAYNNNNRTG 2 cut(s) 37, 210
SmlI CTYRAG 2 cut(s) 290, 299
SmoI CTYRAG 2 cut(s) 290, 299
Sse9I AATT 2 cut(s) 269, 308
SspMI CTAG 1 cut(s) 75
StyD4I CCNGG 2 cut(s) 333, 405
TaaI ACNGT 4 cut(s) 230, 250, 328, 446
TaiI ACGT 1 cut(s) 390
TasI AATT 2 cut(s) 269, 308
TatI WGTACW 2 cut(s) 55, 202
TfiI GAWTC 2 cut(s) 176, 439
Tru1I TTAA 1 cut(s) 300
Tru9I TTAA 1 cut(s) 300
TscAI CASTG 1 cut(s) 25
TspGWI ACGGA 1 cut(s) 141
TspRI CASTG 1 cut(s) 25
Vha464I CTTAAG 1 cut(s) 299
VpaK11BI GGWCC 2 cut(s) 295, 427
XagI CCTNNNNNAGG 2 cut(s) 302, 404
XapI RAATTY 2 cut(s) 269, 308
XspI CTAG 1 cut(s) 75
ZrmI AGTACT 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.