pycom17g07300

Belongs to the glycosyl hydrolase 1 family

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
N/A
Physical Location & Seq
Forward (+)
5258013 .. 5258299
287 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 183 bp
ATGCAGAAAATGGGATTGGAGATGATCATGATGGAACACTTTTGTGGATGCAGAAAAGACTTCACTGCATCTGTAGATGCACACTTAAAAAATTTTGAGGATAGAGTTTTGCATTGGACTGCAATGAATGAGCCTAATGTTTTTATACTTGGAGATCATGTTATGTCATGCATCAGCTGCTAG

Protein Analysis

61

Amino Acids

6.95

Weight (kDa)

5.66

Isoelectric Point (pI)

25.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 91
AjuI GAANNNNNNNTTGG 1 cut(s) 31
AleI CACNNNNGTG 1 cut(s) 42
AluBI AGCT 1 cut(s) 177
AluI AGCT 1 cut(s) 177
ApeKI GCWGC 1 cut(s) 177
ApoI RAATTY 1 cut(s) 91
BbvI GCAGC 1 cut(s) 164
BccI CCATC 1 cut(s) 25
BclI TGATCA 1 cut(s) 24
BfaI CTAG 1 cut(s) 181
BfmI CTRYAG 1 cut(s) 72
BisI GCNGC 1 cut(s) 178
BlsI GCNGC 1 cut(s) 179
BmsI GCATC 3 cut(s) 38, 67, 77
BsaXI ACNNNNNCTCC 2 cut(s) 144, 174
Bse3DI GCAATG 1 cut(s) 129
BseGI GGATG 1 cut(s) 53
BseMI GCAATG 1 cut(s) 129
BseXI GCAGC 1 cut(s) 164
Bsp143I GATC 2 cut(s) 24, 154
BspHI TCATGA 1 cut(s) 27
BsrDI GCAATG 1 cut(s) 129
BssMI GATC 2 cut(s) 24, 154
BstAPI GCANNNNNTGC 1 cut(s) 177
BstF5I GGATG 1 cut(s) 53
BstKTI GATC 2 cut(s) 27, 157
BstMBI GATC 2 cut(s) 24, 154
BstMWI GCNNNNNNNGC 1 cut(s) 177
BstSFI CTRYAG 1 cut(s) 72
BstV1I GCAGC 1 cut(s) 164
BtsCI GGATG 1 cut(s) 53
BtsI GCAGTG 1 cut(s) 63
BtsIMutI CAGTG 1 cut(s) 63
CciI TCATGA 1 cut(s) 27
CviAII CATG 3 cut(s) 28, 158, 168
CviJI RGCY 2 cut(s) 133, 177
CviKI_1 RGCY 2 cut(s) 133, 177
DpnI GATC 2 cut(s) 26, 156
DpnII GATC 2 cut(s) 24, 154
EcoT22I ATGCAT 1 cut(s) 173
FaeI CATG 3 cut(s) 31, 161, 171
FaiI YATR 5 cut(s) 29, 146, 159, 164, 169
FatI CATG 3 cut(s) 27, 157, 167
FbaI TGATCA 1 cut(s) 24
Fnu4HI GCNGC 1 cut(s) 178
FokI GGATG 1 cut(s) 60
Fsp4HI GCNGC 1 cut(s) 178
FspBI CTAG 1 cut(s) 181
FspEI CC 7 cut(s) 2, 17, 30, 83, 100, 135, 147
GluI GCNGC 1 cut(s) 178
Hin1II CATG 3 cut(s) 31, 161, 171
Hpy188III TCNNGA 1 cut(s) 28
HpyCH4V TGCA 7 cut(s) 4, 51, 68, 80, 112, 122, 171
HpyF10VI GCNNNNNNNGC 1 cut(s) 177
Hsp92II CATG 3 cut(s) 31, 161, 171
Ksp22I TGATCA 1 cut(s) 24
Kzo9I GATC 2 cut(s) 24, 154
Lsp1109I GCAGC 1 cut(s) 164
LweI GCATC 3 cut(s) 38, 67, 77
MaeI CTAG 1 cut(s) 181
MalI GATC 2 cut(s) 26, 156
MboI GATC 2 cut(s) 24, 154
MluCI AATT 1 cut(s) 91
MnlI CCTC 1 cut(s) 91
Mph1103I ATGCAT 1 cut(s) 173
MseI TTAA 1 cut(s) 86
MslI CAYNNNNRTG 1 cut(s) 42
MspA1I CMGCKG 1 cut(s) 177
MwoI GCNNNNNNNGC 1 cut(s) 177
NdeII GATC 2 cut(s) 24, 154
NlaIII CATG 3 cut(s) 31, 161, 171
NsiI ATGCAT 1 cut(s) 173
OliI CACNNNNGTG 1 cut(s) 42
PagI TCATGA 1 cut(s) 27
PkrI GCNGC 1 cut(s) 179
PvuII CAGCTG 1 cut(s) 177
RseI CAYNNNNRTG 1 cut(s) 42
SaqAI TTAA 1 cut(s) 86
SatI GCNGC 1 cut(s) 178
Sau3AI GATC 2 cut(s) 24, 154
SetI ASST 1 cut(s) 179
SfaNI GCATC 3 cut(s) 38, 67, 77
SfcI CTRYAG 1 cut(s) 72
SgeI CNNG 3 cut(s) 40, 161, 170
SmiMI CAYNNNNRTG 1 cut(s) 42
Sse9I AATT 1 cut(s) 91
SspMI CTAG 1 cut(s) 181
TasI AATT 1 cut(s) 91
Tru1I TTAA 1 cut(s) 86
Tru9I TTAA 1 cut(s) 86
TscAI CASTG 1 cut(s) 70
TseI GCWGC 1 cut(s) 177
TspDTI ATGAA 1 cut(s) 140
TspRI CASTG 1 cut(s) 70
XapI RAATTY 1 cut(s) 91
XspI CTAG 1 cut(s) 181
Zsp2I ATGCAT 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.