pycom17g13430

General transcription factor 3C polypeptide

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
N/A
Physical Location & Seq
Forward (+)
11049246 .. 11049446
201 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 201 bp
ATGGACCCCCAAAAAGATAAATCAGAACCGTGGTGGTGCAATGGAAAGGTGAAACTGAAGCTTTGCAACATTTACCGAGCTAAGTGGATGGCCAAGGAATTTGTAGATACAATCTATCATCTCGTACATGAGTCACTGAGCATCGAATCACTTCAGCAAAAGGTGAAAGTGAAAAGAAGGCTGACAAAACTGTCCTGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

67

Amino Acids

7.91

Weight (kDa)

9.58

Isoelectric Point (pI)

48.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 190
AcoI YGGCCR 1 cut(s) 90
AcsI RAATTY 1 cut(s) 98
AcuI CTGAAG 2 cut(s) 77, 137
AfaI GTAC 1 cut(s) 126
AluBI AGCT 2 cut(s) 61, 80
AluI AGCT 2 cut(s) 61, 80
AoxI GGCC 1 cut(s) 90
ApoI RAATTY 1 cut(s) 98
Asp700I GAANNNNTTC 1 cut(s) 150
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 2 cut(s) 61, 175
AvaII GGWCC 1 cut(s) 4
BalI TGGCCA 1 cut(s) 92
BccI CCATC 1 cut(s) 82
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 1 cut(s) 6
BmsI GCATC 1 cut(s) 150
BsaJI CCNNGG 2 cut(s) 29, 93
Bse3DI GCAATG 1 cut(s) 46
BseDI CCNNGG 2 cut(s) 29, 93
BseGI GGATG 1 cut(s) 93
BseMI GCAATG 1 cut(s) 46
BseMII CTCAG 1 cut(s) 128
BshFI GGCC 1 cut(s) 92
BsnI GGCC 1 cut(s) 92
BspANI GGCC 1 cut(s) 92
BspCNI CTCAG 1 cut(s) 129
BspLI GGNNCC 1 cut(s) 6
BsrDI GCAATG 1 cut(s) 46
BssECI CCNNGG 2 cut(s) 29, 93
BssT1I CCWWGG 1 cut(s) 93
Bst4CI ACNGT 2 cut(s) 30, 192
BstDEI CTNAG 2 cut(s) 81, 137
BstDSI CCRYGG 1 cut(s) 29
BstF5I GGATG 1 cut(s) 93
BsuRI GGCC 1 cut(s) 92
BtgI CCRYGG 1 cut(s) 29
BtsCI GGATG 1 cut(s) 93
BtsIMutI CAGTG 1 cut(s) 134
Cfr13I GGNCC 1 cut(s) 4
Csp6I GTAC 1 cut(s) 125
CviAII CATG 1 cut(s) 128
CviJI RGCY 4 cut(s) 61, 80, 92, 181
CviKI_1 RGCY 4 cut(s) 61, 80, 92, 181
CviQI GTAC 1 cut(s) 125
DdeI CTNAG 2 cut(s) 81, 137
DrdI GACNNNNNNGTC 1 cut(s) 190
DseDI GACNNNNNNGTC 1 cut(s) 190
EaeI YGGCCR 1 cut(s) 90
Eco130I CCWWGG 1 cut(s) 93
Eco47I GGWCC 1 cut(s) 4
Eco57I CTGAAG 2 cut(s) 77, 137
EcoT14I CCWWGG 1 cut(s) 93
ErhI CCWWGG 1 cut(s) 93
FaeI CATG 1 cut(s) 131
FaiI YATR 1 cut(s) 129
FatI CATG 1 cut(s) 127
FokI GGATG 1 cut(s) 100
HaeIII GGCC 1 cut(s) 92
Hin1II CATG 1 cut(s) 131
HindIII AAGCTT 1 cut(s) 59
HinfI GANTC 2 cut(s) 131, 146
HphI GGTGA 2 cut(s) 61, 175
Hpy188I TCNGA 1 cut(s) 25
HpyAV CCTTC 1 cut(s) 171
HpyCH4III ACNGT 2 cut(s) 30, 192
HpyCH4V TGCA 2 cut(s) 39, 66
HpyF3I CTNAG 2 cut(s) 81, 137
Hsp92II CATG 1 cut(s) 131
LweI GCATC 1 cut(s) 150
MaeIII GTNAC 1 cut(s) 132
MlsI TGGCCA 1 cut(s) 92
MluCI AATT 1 cut(s) 98
MluNI TGGCCA 1 cut(s) 92
MlyI GAGTC 1 cut(s) 140
Mox20I TGGCCA 1 cut(s) 92
MroXI GAANNNNTTC 1 cut(s) 150
MscI TGGCCA 1 cut(s) 92
Msp20I TGGCCA 1 cut(s) 92
NlaIII CATG 1 cut(s) 131
NlaIV GGNNCC 1 cut(s) 6
NmuCI GTSAC 1 cut(s) 132
PdmI GAANNNNTTC 1 cut(s) 150
PfeI GAWTC 1 cut(s) 146
PleI GAGTC 1 cut(s) 139
PpsI GAGTC 1 cut(s) 139
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 4
RsaI GTAC 1 cut(s) 126
RsaNI GTAC 1 cut(s) 125
Sau96I GGNCC 1 cut(s) 4
SchI GAGTC 1 cut(s) 140
SetI ASST 4 cut(s) 51, 63, 82, 165
SfaNI GCATC 1 cut(s) 150
SgeI CNNG 5 cut(s) 42, 89, 106, 134, 140
SinI GGWCC 1 cut(s) 4
Sse9I AATT 1 cut(s) 98
StyI CCWWGG 1 cut(s) 93
TaaI ACNGT 2 cut(s) 30, 192
TaqI TCGA 1 cut(s) 144
TasI AATT 1 cut(s) 98
TfiI GAWTC 1 cut(s) 146
TscAI CASTG 1 cut(s) 141
TseFI GTSAC 1 cut(s) 132
Tsp45I GTSAC 1 cut(s) 132
TspRI CASTG 1 cut(s) 141
VpaK11BI GGWCC 1 cut(s) 4
XapI RAATTY 1 cut(s) 98
XmnI GAANNNNTTC 1 cut(s) 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.