pycom17g15540

F-box-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
N/A
Physical Location & Seq
Reverse (-)
13566338 .. 13567022
685 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 234 bp
ATGCCACCCTCTTCTAGTATACTGAACGAAACCCTCATAGATCAGTTTATTGCTTGTGGGAAATCGAGAGGCATGGCTCATGATCTTGCTTCCCCGATCTGGCTGGCTGTTCTTGATAATTTAGAGGAAAATGATAAAACTTTTCAATTACTTAAACATAACAACTGTCGAAATGCAGAAGACACAGACATGATTAAGTTTATATTGTTGCTGCAACGTGTTAATTTTCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

8.76

Weight (kDa)

5.1

Isoelectric Point (pI)

55.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 19
AfiI CCNNNNNNNGG 1 cut(s) 99
AflIII ACRYGT 1 cut(s) 217
AgsI TTSAA 1 cut(s) 146
ApeKI GCWGC 1 cut(s) 211
BbsI GAAGAC 1 cut(s) 186
BbvI GCAGC 1 cut(s) 198
BfaI CTAG 1 cut(s) 15
BisI GCNGC 1 cut(s) 212
BlsI GCNGC 1 cut(s) 213
BpiI GAAGAC 1 cut(s) 186
Bsc4I CCNNNNNNNGG 1 cut(s) 99
BseLI CCNNNNNNNGG 1 cut(s) 99
BseXI GCAGC 1 cut(s) 198
BslI CCNNNNNNNGG 1 cut(s) 99
Bsp143I GATC 3 cut(s) 40, 82, 96
BspHI TCATGA 1 cut(s) 79
BssMI GATC 3 cut(s) 40, 82, 96
BssNAI GTATAC 1 cut(s) 20
Bst1107I GTATAC 1 cut(s) 20
Bst4CI ACNGT 1 cut(s) 167
Bst6I CTCTTC 1 cut(s) 16
BstC8I GCNNGC 1 cut(s) 105
BstKTI GATC 3 cut(s) 43, 85, 99
BstMBI GATC 3 cut(s) 40, 82, 96
BstV1I GCAGC 1 cut(s) 198
BstV2I GAAGAC 1 cut(s) 186
BstZ17I GTATAC 1 cut(s) 20
Cac8I GCNNGC 1 cut(s) 105
CciI TCATGA 1 cut(s) 79
CviAII CATG 3 cut(s) 73, 80, 190
CviJI RGCY 3 cut(s) 77, 103, 107
CviKI_1 RGCY 3 cut(s) 77, 103, 107
DpnI GATC 3 cut(s) 42, 84, 98
DpnII GATC 3 cut(s) 40, 82, 96
Eam1104I CTCTTC 1 cut(s) 16
EarI CTCTTC 1 cut(s) 16
FaeI CATG 3 cut(s) 76, 83, 193
FaiI YATR 7 cut(s) 20, 38, 74, 81, 159, 191, 203
FatI CATG 3 cut(s) 72, 79, 189
FblI GTMKAC 1 cut(s) 19
Fnu4HI GCNGC 1 cut(s) 212
Fsp4HI GCNGC 1 cut(s) 212
FspBI CTAG 1 cut(s) 15
GluI GCNGC 1 cut(s) 212
Hin1II CATG 3 cut(s) 76, 83, 193
Hpy166II GTNNAC 1 cut(s) 20
Hpy188III TCNNGA 3 cut(s) 66, 80, 113
Hpy8I GTNNAC 1 cut(s) 20
HpyCH4III ACNGT 1 cut(s) 167
HpyCH4IV ACGT 1 cut(s) 217
HpyCH4V TGCA 2 cut(s) 176, 214
HpySE526I ACGT 1 cut(s) 217
Hsp92II CATG 3 cut(s) 76, 83, 193
Kzo9I GATC 3 cut(s) 40, 82, 96
LpnPI CCDG 2 cut(s) 85, 89
Lsp1109I GCAGC 1 cut(s) 198
MaeI CTAG 1 cut(s) 15
MaeII ACGT 1 cut(s) 217
MalI GATC 3 cut(s) 42, 84, 98
MboI GATC 3 cut(s) 40, 82, 96
MboII GAAGA 2 cut(s) 3, 191
MluCI AATT 3 cut(s) 118, 146, 223
MnlI CCTC 4 cut(s) 19, 44, 62, 118
MseI TTAA 3 cut(s) 153, 195, 222
MslI CAYNNNNRTG 1 cut(s) 188
NdeII GATC 3 cut(s) 40, 82, 96
NlaIII CATG 3 cut(s) 76, 83, 193
PagI TCATGA 1 cut(s) 79
PkrI GCNGC 1 cut(s) 213
RseI CAYNNNNRTG 1 cut(s) 188
SaqAI TTAA 3 cut(s) 153, 195, 222
SatI GCNGC 1 cut(s) 212
Sau3AI GATC 3 cut(s) 40, 82, 96
SetI ASST 1 cut(s) 220
SmiMI CAYNNNNRTG 1 cut(s) 188
Sse9I AATT 3 cut(s) 118, 146, 223
SspMI CTAG 1 cut(s) 15
TaaI ACNGT 1 cut(s) 167
TaiI ACGT 1 cut(s) 220
TaqI TCGA 2 cut(s) 65, 169
TasI AATT 3 cut(s) 118, 146, 223
Tru1I TTAA 3 cut(s) 153, 195, 222
Tru9I TTAA 3 cut(s) 153, 195, 222
TseI GCWGC 1 cut(s) 211
XmiI GTMKAC 1 cut(s) 19
XspI CTAG 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.