pycom17g18920

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
N/A
Physical Location & Seq
Forward (+)
16471265 .. 16472115
851 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 258 bp
ATGGGGTCATTGGCGCTTAACAGCCGGCATCCGGACGATGTTCTTGATCGCTACTGGTGGGTGCCTCCTGATAATAATACACAATACTACATTTACATGCACTTTGCAGAAGTTAAAAAGCAAAACCAGTCTAGATGGCTTTACATTTTAAGGAACGGGGAGTCCTTTCAGGGGATGGGAGTTTACAAAGTGTTGACAATCTCACAACCCAAAAGCCCAATACACCCAATAGCTCTCACACACCAAAGAAACAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

86

Amino Acids

10.09

Weight (kDa)

9.57

Isoelectric Point (pI)

58.15

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Malectin_like PF12819 19 - 58 1.6e-06 Malectin-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 61
AccIII TCCGGA 1 cut(s) 31
AfiI CCNNNNNNNGG 2 cut(s) 31, 171
AloI GAACNNNNNNTCC 2 cut(s) 146, 178
AluBI AGCT 1 cut(s) 233
AluI AGCT 1 cut(s) 233
Aor13HI TCCGGA 1 cut(s) 31
AspLEI GCGC 1 cut(s) 16
BanI GGYRCC 1 cut(s) 61
BccI CCATC 2 cut(s) 129, 169
BfaI CTAG 1 cut(s) 132
BfoI RGCGCY 1 cut(s) 17
BmiI GGNNCC 1 cut(s) 63
BmsI GCATC 1 cut(s) 37
BsaWI WCCGGW 1 cut(s) 31
Bsc4I CCNNNNNNNGG 2 cut(s) 31, 171
Bse118I RCCGGY 1 cut(s) 24
Bse1I ACTGG 2 cut(s) 59, 127
BseAI TCCGGA 1 cut(s) 31
BseGI GGATG 2 cut(s) 28, 180
BseLI CCNNNNNNNGG 2 cut(s) 31, 171
BseNI ACTGG 2 cut(s) 59, 127
BshNI GGYRCC 1 cut(s) 61
BsiSI CCGG 2 cut(s) 25, 32
BslI CCNNNNNNNGG 2 cut(s) 31, 171
Bsp13I TCCGGA 1 cut(s) 31
Bsp143I GATC 1 cut(s) 46
BspEI TCCGGA 1 cut(s) 31
BspLI GGNNCC 1 cut(s) 63
BspT107I GGYRCC 1 cut(s) 61
BsrFI RCCGGY 1 cut(s) 24
BsrI ACTGG 2 cut(s) 59, 127
BssAI RCCGGY 1 cut(s) 24
BssMI GATC 1 cut(s) 46
BstC8I GCNNGC 1 cut(s) 26
BstF5I GGATG 2 cut(s) 28, 180
BstH2I RGCGCY 1 cut(s) 17
BstHHI GCGC 1 cut(s) 16
BstKTI GATC 1 cut(s) 49
BstMBI GATC 1 cut(s) 46
BstNSI RCATGY 1 cut(s) 100
BtsCI GGATG 2 cut(s) 28, 180
Cac8I GCNNGC 1 cut(s) 26
CfoI GCGC 1 cut(s) 16
Cfr10I RCCGGY 1 cut(s) 24
CviAII CATG 1 cut(s) 97
CviJI RGCY 4 cut(s) 24, 139, 216, 233
CviKI_1 RGCY 4 cut(s) 24, 139, 216, 233
DpnI GATC 1 cut(s) 48
DpnII GATC 1 cut(s) 46
FaeI CATG 1 cut(s) 100
FaiI YATR 1 cut(s) 98
FatI CATG 1 cut(s) 96
FokI GGATG 2 cut(s) 15, 187
FspBI CTAG 1 cut(s) 132
GlaI GCGC 1 cut(s) 15
HaeII RGCGCY 1 cut(s) 17
HapII CCGG 2 cut(s) 25, 32
HhaI GCGC 1 cut(s) 16
Hin1II CATG 1 cut(s) 100
Hin6I GCGC 1 cut(s) 14
HinP1I GCGC 1 cut(s) 14
HincII GTYRAC 1 cut(s) 195
HindII GTYRAC 1 cut(s) 195
HinfI GANTC 1 cut(s) 161
HpaII CCGG 2 cut(s) 25, 32
Hpy166II GTNNAC 2 cut(s) 184, 195
Hpy188III TCNNGA 4 cut(s) 32, 44, 68, 132
Hpy8I GTNNAC 2 cut(s) 184, 195
HpyCH4V TGCA 2 cut(s) 100, 107
Hsp92II CATG 1 cut(s) 100
HspAI GCGC 1 cut(s) 14
Kpn2I TCCGGA 1 cut(s) 31
KroI GCCGGC 1 cut(s) 24
KroNI GCCGGC 1 cut(s) 26
Kzo9I GATC 1 cut(s) 46
LpnPI CCDG 6 cut(s) 38, 40, 45, 81, 140, 155
LweI GCATC 1 cut(s) 37
MaeI CTAG 1 cut(s) 132
MalI GATC 1 cut(s) 48
MboI GATC 1 cut(s) 46
MlyI GAGTC 1 cut(s) 170
MnlI CCTC 1 cut(s) 75
MroI TCCGGA 1 cut(s) 31
MroNI GCCGGC 1 cut(s) 24
MseI TTAA 3 cut(s) 18, 114, 149
MslI CAYNNNNRTG 1 cut(s) 95
MspI CCGG 2 cut(s) 25, 32
NaeI GCCGGC 1 cut(s) 26
NdeII GATC 1 cut(s) 46
NgoMIV GCCGGC 1 cut(s) 24
NlaIII CATG 1 cut(s) 100
NlaIV GGNNCC 1 cut(s) 63
NspI RCATGY 1 cut(s) 100
PdiI GCCGGC 1 cut(s) 26
PleI GAGTC 1 cut(s) 169
PpsI GAGTC 1 cut(s) 169
PspN4I GGNNCC 1 cut(s) 63
RseI CAYNNNNRTG 1 cut(s) 95
SaqAI TTAA 3 cut(s) 18, 114, 149
Sau3AI GATC 1 cut(s) 46
SchI GAGTC 1 cut(s) 170
SetI ASST 1 cut(s) 235
SfaNI GCATC 1 cut(s) 37
SmiMI CAYNNNNRTG 1 cut(s) 95
SspMI CTAG 1 cut(s) 132
Tru1I TTAA 3 cut(s) 18, 114, 149
Tru9I TTAA 3 cut(s) 18, 114, 149
XbaI TCTAGA 1 cut(s) 131
XceI RCATGY 1 cut(s) 100
XspI CTAG 1 cut(s) 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.