pycom17g21260

TMV resistance protein N-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
N/A
Physical Location & Seq
Forward (+)
19697547 .. 19698074
528 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 360 bp
ATGATTCTGAGAAGGACATATTTCTGGATATTTCTTGACAGTTGTGGCTTTTATCCCCATACTGGGATAAGAGTTCTAATTGATCGAGCTCTTATAACTGTCTCTTGGGAAACACTAGAGATGCACGATTTACTAGACGAATGGGTCGGGAAATCGTTCGCCAAGAATCTATTAAAGTGCCTGGGAAACACAGTAGATTGTGGAATTATGAAGATGTTCATCATCTTTAGAGTAAACAAATTTAACTTTGACCAAAATATAATTCTTAGAAACATCCAGGCTACAGAAGTTGTTGAAAGCATAATCCTTTCATTCTCAAAGCTAAAAGTGGTATACTTAAGGTTCGAAGATTTTTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_3 NB-ARC TIR

Protein Analysis

120

Amino Acids

14.12

Weight (kDa)

7.72

Isoelectric Point (pI)

43.17

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
WHD_ROQ1 PF23282 11 - 47 3.2e-08 Disease resistance protein Roq1-like, winged-helix domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 95
AasI GACNNNNNNGTC 1 cut(s) 143
AccI GTMKAC 1 cut(s) 333
AcsI RAATTY 1 cut(s) 239
AfiI CCNNNNNNNGG 2 cut(s) 62, 63
AflII CTTAAG 1 cut(s) 337
AgsI TTSAA 1 cut(s) 296
AjnI CCWGG 2 cut(s) 180, 276
AjuI GAANNNNNNNTTGG 2 cut(s) 246, 278
AluBI AGCT 2 cut(s) 89, 322
AluI AGCT 2 cut(s) 89, 322
Alw21I GWGCWC 1 cut(s) 91
Alw26I GTCTC 1 cut(s) 106
ApoI RAATTY 1 cut(s) 239
Asp700I GAANNNNTTC 2 cut(s) 155, 215
AsuII TTCGAA 1 cut(s) 345
BanII GRGCYC 1 cut(s) 91
Bbv12I GWGCWC 1 cut(s) 91
BciT130I CCWGG 2 cut(s) 182, 278
BcoDI GTCTC 1 cut(s) 106
BfaI CTAG 2 cut(s) 116, 134
BfmI CTRYAG 1 cut(s) 282
BfrI CTTAAG 1 cut(s) 337
Bme1390I CCNGG 2 cut(s) 182, 278
BmrFI CCNGG 2 cut(s) 182, 278
BmrI ACTGGG 1 cut(s) 72
BmsI GCATC 1 cut(s) 111
BmuI ACTGGG 1 cut(s) 72
Bpu14I TTCGAA 1 cut(s) 345
BsaBI GATNNNNATC 1 cut(s) 218
BsaJI CCNNGG 1 cut(s) 181
Bsc4I CCNNNNNNNGG 2 cut(s) 62, 63
Bse1I ACTGG 1 cut(s) 67
Bse8I GATNNNNATC 1 cut(s) 218
BseBI CCWGG 2 cut(s) 182, 278
BseDI CCNNGG 1 cut(s) 181
BseGI GGATG 1 cut(s) 273
BseJI GATNNNNATC 1 cut(s) 218
BseLI CCNNNNNNNGG 2 cut(s) 62, 63
BseNI ACTGG 1 cut(s) 67
BsiHKAI GWGCWC 1 cut(s) 91
BslI CCNNNNNNNGG 2 cut(s) 62, 63
BsmAI GTCTC 1 cut(s) 106
Bsp119I TTCGAA 1 cut(s) 345
Bsp1286I GDGCHC 1 cut(s) 91
Bsp143I GATC 1 cut(s) 82
BspT104I TTCGAA 1 cut(s) 345
BspTI CTTAAG 1 cut(s) 337
BsrI ACTGG 1 cut(s) 67
BssECI CCNNGG 1 cut(s) 181
BssMI GATC 1 cut(s) 82
BssNAI GTATAC 1 cut(s) 334
Bst1107I GTATAC 1 cut(s) 334
Bst2UI CCWGG 2 cut(s) 182, 278
Bst4CI ACNGT 3 cut(s) 41, 100, 193
BstAFI CTTAAG 1 cut(s) 337
BstBI TTCGAA 1 cut(s) 345
BstDEI CTNAG 2 cut(s) 8, 266
BstF5I GGATG 1 cut(s) 273
BstKTI GATC 1 cut(s) 85
BstMAI GTCTC 1 cut(s) 106
BstMBI GATC 1 cut(s) 82
BstNI CCWGG 2 cut(s) 182, 278
BstSCI CCNGG 2 cut(s) 180, 276
BstSFI CTRYAG 1 cut(s) 282
BstZ17I GTATAC 1 cut(s) 334
BtsCI GGATG 1 cut(s) 273
CviJI RGCY 4 cut(s) 48, 89, 281, 322
CviKI_1 RGCY 4 cut(s) 48, 89, 281, 322
DdeI CTNAG 2 cut(s) 8, 266
DpnI GATC 1 cut(s) 84
DpnII GATC 1 cut(s) 82
DrdI GACNNNNNNGTC 1 cut(s) 143
DseDI GACNNNNNNGTC 1 cut(s) 143
Ecl136II GAGCTC 1 cut(s) 89
Eco24I GRGCYC 1 cut(s) 91
Eco53kI GAGCTC 1 cut(s) 89
EcoICRI GAGCTC 1 cut(s) 89
EcoRII CCWGG 2 cut(s) 180, 276
EcoT38I GRGCYC 1 cut(s) 91
FaiI YATR 7 cut(s) 19, 60, 95, 209, 260, 302, 334
FblI GTMKAC 1 cut(s) 333
FokI GGATG 1 cut(s) 260
FriOI GRGCYC 1 cut(s) 91
FspBI CTAG 2 cut(s) 116, 134
HinfI GANTC 2 cut(s) 4, 166
Hpy166II GTNNAC 2 cut(s) 235, 334
Hpy188I TCNGA 1 cut(s) 9
Hpy188III TCNNGA 3 cut(s) 25, 35, 148
Hpy8I GTNNAC 2 cut(s) 235, 334
HpyAV CCTTC 1 cut(s) 6
HpyCH4III ACNGT 3 cut(s) 41, 100, 193
HpyCH4V TGCA 1 cut(s) 124
HpyF3I CTNAG 2 cut(s) 8, 266
Kzo9I GATC 1 cut(s) 82
LpnPI CCDG 6 cut(s) 10, 48, 167, 194, 263, 290
LweI GCATC 1 cut(s) 111
MaeI CTAG 2 cut(s) 116, 134
MalI GATC 1 cut(s) 84
MboI GATC 1 cut(s) 82
MboII GAAGA 2 cut(s) 223, 359
MhlI GDGCHC 1 cut(s) 91
MluCI AATT 4 cut(s) 78, 204, 239, 261
MroXI GAANNNNTTC 2 cut(s) 155, 215
MseI TTAA 4 cut(s) 173, 243, 338, 358
MspCI CTTAAG 1 cut(s) 337
MspR9I CCNGG 2 cut(s) 182, 278
MvaI CCWGG 2 cut(s) 182, 278
NdeII GATC 1 cut(s) 82
NspV TTCGAA 1 cut(s) 345
PdmI GAANNNNTTC 2 cut(s) 155, 215
PfeI GAWTC 2 cut(s) 4, 166
PsiI TTATAA 1 cut(s) 95
Psp124BI GAGCTC 1 cut(s) 91
Psp6I CCWGG 2 cut(s) 180, 276
PspGI CCWGG 2 cut(s) 180, 276
SacI GAGCTC 1 cut(s) 91
SaqAI TTAA 4 cut(s) 173, 243, 338, 358
Sau3AI GATC 1 cut(s) 82
ScrFI CCNGG 2 cut(s) 182, 278
SduI GDGCHC 1 cut(s) 91
SetI ASST 3 cut(s) 91, 324, 344
SfaNI GCATC 1 cut(s) 111
SfcI CTRYAG 1 cut(s) 282
SfuI TTCGAA 1 cut(s) 345
SmlI CTYRAG 1 cut(s) 337
SmoI CTYRAG 1 cut(s) 337
Sse9I AATT 4 cut(s) 78, 204, 239, 261
SspMI CTAG 2 cut(s) 116, 134
SstI GAGCTC 1 cut(s) 91
StyD4I CCNGG 2 cut(s) 180, 276
TaaI ACNGT 3 cut(s) 41, 100, 193
TaqI TCGA 2 cut(s) 85, 345
TasI AATT 4 cut(s) 78, 204, 239, 261
TfiI GAWTC 2 cut(s) 4, 166
Tru1I TTAA 4 cut(s) 173, 243, 338, 358
Tru9I TTAA 4 cut(s) 173, 243, 338, 358
TspDTI ATGAA 3 cut(s) 208, 224, 300
Vha464I CTTAAG 1 cut(s) 337
XapI RAATTY 1 cut(s) 239
XmiI GTMKAC 1 cut(s) 333
XmnI GAANNNNTTC 2 cut(s) 155, 215
XspI CTAG 2 cut(s) 116, 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.