pycom17g22660

Cinnamoyl-CoA reductase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
N/A
Physical Location & Seq
Forward (+)
21033705 .. 21034612
908 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 195 bp
ATGATGTCGTGTAAAAATAATGGGAAATCCAGAGCGGAATCATACAAGTTCGCAAACCAGAAGCTACGAGACTTAGGGTTGGAGTTCACCCCAGTCAAACATACCCTGTATGAAACTGTCAGGAGCTTGCAGGAGAAGGGCCACCTTCCAGTCCCTACAAAACAAGAACAAGATTCCATTAAAATTCAATCTTAA

Protein Analysis

65

Amino Acids

7.37

Weight (kDa)

9.46

Isoelectric Point (pI)

67.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 35
AciI CCGC 1 cut(s) 35
AcsI RAATTY 1 cut(s) 183
AgsI TTSAA 1 cut(s) 188
AluBI AGCT 2 cut(s) 64, 126
AluI AGCT 2 cut(s) 64, 126
Alw26I GTCTC 1 cut(s) 63
AoxI GGCC 1 cut(s) 139
ApoI RAATTY 1 cut(s) 183
AspS9I GGNCC 1 cut(s) 139
AsuHPI GGTGA 1 cut(s) 79
BcoDI GTCTC 1 cut(s) 63
BmgT120I GGNCC 1 cut(s) 139
BmrI ACTGGG 1 cut(s) 86
BmuI ACTGGG 1 cut(s) 86
Bse1I ACTGG 2 cut(s) 92, 149
BseNI ACTGG 2 cut(s) 92, 149
BshFI GGCC 1 cut(s) 141
BslFI GGGAC 1 cut(s) 137
BsmAI GTCTC 1 cut(s) 63
BsmFI GGGAC 1 cut(s) 137
BsnI GGCC 1 cut(s) 141
BspACI CCGC 1 cut(s) 35
BspANI GGCC 1 cut(s) 141
BsrBI CCGCTC 1 cut(s) 35
BsrI ACTGG 2 cut(s) 92, 149
Bst4CI ACNGT 1 cut(s) 118
BstC8I GCNNGC 1 cut(s) 128
BstDEI CTNAG 1 cut(s) 73
BstMAI GTCTC 1 cut(s) 63
BsuRI GGCC 1 cut(s) 141
Cac8I GCNNGC 1 cut(s) 128
Cfr13I GGNCC 1 cut(s) 139
CviJI RGCY 3 cut(s) 64, 126, 141
CviKI_1 RGCY 3 cut(s) 64, 126, 141
DdeI CTNAG 1 cut(s) 73
FaiI YATR 3 cut(s) 43, 102, 111
FaqI GGGAC 1 cut(s) 137
HaeIII GGCC 1 cut(s) 141
HinfI GANTC 2 cut(s) 38, 173
HphI GGTGA 1 cut(s) 79
Hpy166II GTNNAC 1 cut(s) 87
Hpy188III TCNNGA 2 cut(s) 30, 121
Hpy8I GTNNAC 1 cut(s) 87
HpyAV CCTTC 2 cut(s) 130, 155
HpyCH4III ACNGT 1 cut(s) 118
HpyCH4V TGCA 1 cut(s) 130
HpyF3I CTNAG 1 cut(s) 73
LmnI GCTCC 1 cut(s) 123
LpnPI CCDG 7 cut(s) 43, 71, 105, 106, 116, 119, 162
MbiI CCGCTC 1 cut(s) 35
MluCI AATT 1 cut(s) 183
MmeI TCCRAC 1 cut(s) 60
MseI TTAA 2 cut(s) 180, 193
PfeI GAWTC 2 cut(s) 38, 173
PspPI GGNCC 1 cut(s) 139
SaqAI TTAA 2 cut(s) 180, 193
Sau96I GGNCC 1 cut(s) 139
SetI ASST 3 cut(s) 66, 128, 147
Sse9I AATT 1 cut(s) 183
SsiI CCGC 1 cut(s) 35
TaaI ACNGT 1 cut(s) 118
TasI AATT 1 cut(s) 183
TfiI GAWTC 2 cut(s) 38, 173
Tru1I TTAA 2 cut(s) 180, 193
Tru9I TTAA 2 cut(s) 180, 193
TspDTI ATGAA 1 cut(s) 126
XapI RAATTY 1 cut(s) 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.