pycom17g23450

modification-dependent protein catabolic process

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
N/A
Physical Location & Seq
Reverse (-)
21824710 .. 21824961
252 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 252 bp
ATGTCATCGTCGTCAAAGAAGATCACCCTCAAGAGCTCGGACGGTGAGTCGTTCGAGGTTGAGGAGGTGATGGTGCTGGAGTCGCATACCATCAAGCACATGATTGAGGACGATTGCACTAACAACGGCATGTCGACGCCACGAAGCCCGACGAGAAGATCTCCGAGGACGATCTCAAGGCCTGGGATTAGAATTTGGTTTGATTCTAGGGTTTCAAAATTTGGGGATTCAGTTGGTTTAAGGTTTTTTTGA
Functional Annotation

Protein Analysis

84

Amino Acids

9.41

Weight (kDa)

9.03

Isoelectric Point (pI)

80.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Skp1_POZ PF03931 6 - 43 4.7e-14 Skp1 family, tetramerisation domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 134
AcsI RAATTY 2 cut(s) 192, 218
AcyI GRCGYC 1 cut(s) 137
AgsI TTSAA 1 cut(s) 216
AhdI GACNNNNNGTC 1 cut(s) 46
AjnI CCWGG 1 cut(s) 181
AluBI AGCT 1 cut(s) 36
AluI AGCT 1 cut(s) 36
Alw21I GWGCWC 1 cut(s) 38
AoxI GGCC 1 cut(s) 179
ApoI RAATTY 2 cut(s) 192, 218
AsuHPI GGTGA 3 cut(s) 16, 56, 79
BanII GRGCYC 1 cut(s) 38
Bbv12I GWGCWC 1 cut(s) 38
BccI CCATC 2 cut(s) 64, 98
BceAI ACGGC 1 cut(s) 142
BciT130I CCWGG 1 cut(s) 183
BfaI CTAG 1 cut(s) 207
BglII AGATCT 1 cut(s) 158
Bme1390I CCNGG 1 cut(s) 183
BmeRI GACNNNNNGTC 1 cut(s) 46
BmrFI CCNGG 1 cut(s) 183
BplI GAGNNNNNCTC 2 cut(s) 145, 177
BpmI CTGGAG 1 cut(s) 98
BpuEI CTTGAG 2 cut(s) 14, 160
BsaHI GRCGYC 1 cut(s) 137
BsaJI CCNNGG 2 cut(s) 164, 182
BseBI CCWGG 1 cut(s) 183
BseDI CCNNGG 2 cut(s) 164, 182
BseRI GAGGAG 1 cut(s) 77
BshFI GGCC 1 cut(s) 181
BsiHKAI GWGCWC 1 cut(s) 38
BsnI GGCC 1 cut(s) 181
Bsp1286I GDGCHC 1 cut(s) 38
Bsp143I GATC 3 cut(s) 21, 158, 171
BspANI GGCC 1 cut(s) 181
BssECI CCNNGG 2 cut(s) 164, 182
BssMI GATC 3 cut(s) 21, 158, 171
BssNI GRCGYC 1 cut(s) 137
Bst2UI CCWGG 1 cut(s) 183
Bst4CI ACNGT 1 cut(s) 44
BstACI GRCGYC 1 cut(s) 137
BstKTI GATC 3 cut(s) 24, 161, 174
BstMBI GATC 3 cut(s) 21, 158, 171
BstMWI GCNNNNNNNGC 1 cut(s) 82
BstNI CCWGG 1 cut(s) 183
BstNSI RCATGY 1 cut(s) 133
BstSCI CCNGG 1 cut(s) 181
BstX2I RGATCY 1 cut(s) 158
BstYI RGATCY 1 cut(s) 158
BsuRI GGCC 1 cut(s) 181
CseI GACGC 1 cut(s) 145
CviAII CATG 2 cut(s) 100, 130
CviJI RGCY 3 cut(s) 36, 147, 181
CviKI_1 RGCY 3 cut(s) 36, 147, 181
DpnI GATC 3 cut(s) 23, 160, 173
DpnII GATC 3 cut(s) 21, 158, 171
DriI GACNNNNNGTC 1 cut(s) 46
Eam1105I GACNNNNNGTC 1 cut(s) 46
Ecl136II GAGCTC 1 cut(s) 36
Eco147I AGGCCT 1 cut(s) 181
Eco24I GRGCYC 1 cut(s) 38
Eco53kI GAGCTC 1 cut(s) 36
EcoICRI GAGCTC 1 cut(s) 36
EcoRII CCWGG 1 cut(s) 181
EcoT38I GRGCYC 1 cut(s) 38
FaeI CATG 2 cut(s) 103, 133
FaiI YATR 3 cut(s) 87, 101, 131
FatI CATG 2 cut(s) 99, 129
FblI GTMKAC 1 cut(s) 134
FriOI GRGCYC 1 cut(s) 38
FspBI CTAG 1 cut(s) 207
GsuI CTGGAG 1 cut(s) 98
HaeIII GGCC 1 cut(s) 181
HgaI GACGC 1 cut(s) 145
Hin1I GRCGYC 1 cut(s) 137
Hin1II CATG 2 cut(s) 103, 133
HincII GTYRAC 1 cut(s) 135
HindII GTYRAC 1 cut(s) 135
HinfI GANTC 4 cut(s) 47, 80, 203, 227
HphI GGTGA 3 cut(s) 16, 56, 79
Hpy166II GTNNAC 1 cut(s) 135
Hpy188I TCNGA 2 cut(s) 40, 165
Hpy188III TCNNGA 1 cut(s) 31
Hpy8I GTNNAC 1 cut(s) 135
Hpy99I CGWCG 3 cut(s) 13, 139, 154
HpyCH4III ACNGT 1 cut(s) 44
HpyCH4V TGCA 1 cut(s) 117
HpyF10VI GCNNNNNNNGC 1 cut(s) 82
Hsp92I GRCGYC 1 cut(s) 137
Hsp92II CATG 2 cut(s) 103, 133
Kzo9I GATC 3 cut(s) 21, 158, 171
LpnPI CCDG 3 cut(s) 62, 168, 195
MaeI CTAG 1 cut(s) 207
MalI GATC 3 cut(s) 23, 160, 173
MboI GATC 3 cut(s) 21, 158, 171
MboII GAAGA 2 cut(s) 31, 168
MflI RGATCY 1 cut(s) 158
MhlI GDGCHC 1 cut(s) 38
MluCI AATT 2 cut(s) 192, 218
MlyI GAGTC 2 cut(s) 56, 89
MnlI CCTC 6 cut(s) 38, 49, 55, 58, 100, 159
MseI TTAA 1 cut(s) 239
MspR9I CCNGG 1 cut(s) 183
MvaI CCWGG 1 cut(s) 183
MwoI GCNNNNNNNGC 1 cut(s) 82
NdeII GATC 3 cut(s) 21, 158, 171
NlaIII CATG 2 cut(s) 103, 133
NspI RCATGY 1 cut(s) 133
PceI AGGCCT 1 cut(s) 181
PfeI GAWTC 2 cut(s) 203, 227
PleI GAGTC 2 cut(s) 55, 88
PpsI GAGTC 2 cut(s) 55, 88
Psp124BI GAGCTC 1 cut(s) 38
Psp6I CCWGG 1 cut(s) 181
PspGI CCWGG 1 cut(s) 181
PsuI RGATCY 1 cut(s) 158
SacI GAGCTC 1 cut(s) 38
SalI GTCGAC 1 cut(s) 133
SaqAI TTAA 1 cut(s) 239
Sau3AI GATC 3 cut(s) 21, 158, 171
SchI GAGTC 2 cut(s) 56, 89
ScrFI CCNGG 1 cut(s) 183
SduI GDGCHC 1 cut(s) 38
SetI ASST 4 cut(s) 38, 60, 69, 245
SmlI CTYRAG 2 cut(s) 29, 175
SmoI CTYRAG 2 cut(s) 29, 175
Sse9I AATT 2 cut(s) 192, 218
SseBI AGGCCT 1 cut(s) 181
SspMI CTAG 1 cut(s) 207
SstI GAGCTC 1 cut(s) 38
StuI AGGCCT 1 cut(s) 181
StyD4I CCNGG 1 cut(s) 181
TaaI ACNGT 1 cut(s) 44
TaqI TCGA 2 cut(s) 54, 134
TasI AATT 2 cut(s) 192, 218
TfiI GAWTC 2 cut(s) 203, 227
Tru1I TTAA 1 cut(s) 239
Tru9I TTAA 1 cut(s) 239
XapI RAATTY 2 cut(s) 192, 218
XceI RCATGY 1 cut(s) 133
XmiI GTMKAC 1 cut(s) 134
XspI CTAG 1 cut(s) 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.