pycom17g25910

Belongs to the class-I aminoacyl-tRNA synthetase family

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
N/A
Physical Location & Seq
Forward (+)
24257873 .. 24258103
231 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 231 bp
ATGATAAACTCTCCTGGTTACCAAGAAAAGACATCTGAAAAGATTCAAGAATCTAACGCTGACAAGCTAGAATTCTTGAAGCAGGAAATAAGTACTCTGGGAAGGGTATGGTGGATGAATTCTCCTGGTTACCGAGAAAAGGCGTCTGAGGAAAATCAAGCATCTGATGCTGACAATCTAGAATTCTTGGAGAAGGAAATAATGGAAAGGCTGCGATGCTCCTTTCTTTAA

Protein Analysis

77

Amino Acids

8.92

Weight (kDa)

4.69

Isoelectric Point (pI)

42.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 3 cut(s) 71, 118, 182
AcyI GRCGYC 1 cut(s) 143
AfaI GTAC 1 cut(s) 94
AfiI CCNNNNNNNGG 1 cut(s) 139
AgsI TTSAA 2 cut(s) 47, 79
AjnI CCWGG 2 cut(s) 13, 124
AluBI AGCT 1 cut(s) 67
AluI AGCT 1 cut(s) 67
ApeKI GCWGC 1 cut(s) 211
ApoI RAATTY 3 cut(s) 71, 118, 182
Asp700I GAANNNNTTC 1 cut(s) 42
BbvI GCAGC 1 cut(s) 198
BciT130I CCWGG 2 cut(s) 15, 126
BfaI CTAG 2 cut(s) 68, 179
BisI GCNGC 1 cut(s) 212
BlsI GCNGC 1 cut(s) 213
BmcAI AGTACT 1 cut(s) 94
Bme1390I CCNGG 2 cut(s) 15, 126
BmrFI CCNGG 2 cut(s) 15, 126
BmsI GCATC 3 cut(s) 157, 170, 206
BsaHI GRCGYC 1 cut(s) 143
Bsc4I CCNNNNNNNGG 1 cut(s) 139
BseBI CCWGG 2 cut(s) 15, 126
BseGI GGATG 1 cut(s) 120
BseLI CCNNNNNNNGG 1 cut(s) 139
BseMII CTCAG 1 cut(s) 138
BseXI GCAGC 1 cut(s) 198
BslI CCNNNNNNNGG 1 cut(s) 139
BspCNI CTCAG 1 cut(s) 139
BssNI GRCGYC 1 cut(s) 143
Bst2UI CCWGG 2 cut(s) 15, 126
BstACI GRCGYC 1 cut(s) 143
BstAPI GCANNNNNTGC 1 cut(s) 167
BstDEI CTNAG 1 cut(s) 147
BstEII GGTNACC 2 cut(s) 17, 128
BstF5I GGATG 1 cut(s) 120
BstMWI GCNNNNNNNGC 1 cut(s) 167
BstNI CCWGG 2 cut(s) 15, 126
BstPI GGTNACC 2 cut(s) 17, 128
BstSCI CCNGG 2 cut(s) 13, 124
BstV1I GCAGC 1 cut(s) 198
BtsCI GGATG 1 cut(s) 120
CseI GACGC 1 cut(s) 132
Csp6I GTAC 1 cut(s) 93
CviJI RGCY 2 cut(s) 67, 211
CviKI_1 RGCY 2 cut(s) 67, 211
CviQI GTAC 1 cut(s) 93
DdeI CTNAG 1 cut(s) 147
Eco91I GGTNACC 2 cut(s) 17, 128
EcoO65I GGTNACC 2 cut(s) 17, 128
EcoRI GAATTC 3 cut(s) 71, 118, 182
EcoRII CCWGG 2 cut(s) 13, 124
FaiI YATR 1 cut(s) 109
Fnu4HI GCNGC 1 cut(s) 212
FokI GGATG 1 cut(s) 127
Fsp4HI GCNGC 1 cut(s) 212
FspBI CTAG 2 cut(s) 68, 179
GluI GCNGC 1 cut(s) 212
HgaI GACGC 1 cut(s) 132
Hin1I GRCGYC 1 cut(s) 143
HinfI GANTC 2 cut(s) 43, 50
Hpy188I TCNGA 3 cut(s) 37, 148, 166
Hpy188III TCNNGA 3 cut(s) 47, 76, 179
HpyAV CCTTC 2 cut(s) 96, 187
HpyF10VI GCNNNNNNNGC 1 cut(s) 167
HpyF3I CTNAG 1 cut(s) 147
Hsp92I GRCGYC 1 cut(s) 143
LmnI GCTCC 1 cut(s) 224
LpnPI CCDG 5 cut(s) 27, 68, 83, 111, 138
Lsp1109I GCAGC 1 cut(s) 198
LweI GCATC 3 cut(s) 157, 170, 206
MaeI CTAG 2 cut(s) 68, 179
MaeIII GTNAC 2 cut(s) 17, 128
MluCI AATT 3 cut(s) 71, 118, 182
MnlI CCTC 1 cut(s) 142
MroXI GAANNNNTTC 1 cut(s) 42
MseI TTAA 1 cut(s) 229
MspR9I CCNGG 2 cut(s) 15, 126
MvaI CCWGG 2 cut(s) 15, 126
MwoI GCNNNNNNNGC 1 cut(s) 167
PdmI GAANNNNTTC 1 cut(s) 42
PfeI GAWTC 2 cut(s) 43, 50
PkrI GCNGC 1 cut(s) 213
Psp6I CCWGG 2 cut(s) 13, 124
PspEI GGTNACC 2 cut(s) 17, 128
PspGI CCWGG 2 cut(s) 13, 124
RsaI GTAC 1 cut(s) 94
RsaNI GTAC 1 cut(s) 93
SaqAI TTAA 1 cut(s) 229
SatI GCNGC 1 cut(s) 212
ScaI AGTACT 1 cut(s) 94
ScrFI CCNGG 2 cut(s) 15, 126
SetI ASST 1 cut(s) 69
SfaNI GCATC 3 cut(s) 157, 170, 206
Sse9I AATT 3 cut(s) 71, 118, 182
SspMI CTAG 2 cut(s) 68, 179
StyD4I CCNGG 2 cut(s) 13, 124
TasI AATT 3 cut(s) 71, 118, 182
TatI WGTACW 1 cut(s) 92
TfiI GAWTC 2 cut(s) 43, 50
Tru1I TTAA 1 cut(s) 229
Tru9I TTAA 1 cut(s) 229
TseI GCWGC 1 cut(s) 211
TspDTI ATGAA 1 cut(s) 131
XapI RAATTY 3 cut(s) 71, 118, 182
XbaI TCTAGA 1 cut(s) 178
XmnI GAANNNNTTC 1 cut(s) 42
XspI CTAG 2 cut(s) 68, 179
ZrmI AGTACT 1 cut(s) 94
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.