pycom17g27230

Protein FAR1-RELATED SEQUENCE 5-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
N/A
Physical Location & Seq
Forward (+)
25513257 .. 25515072
1816 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 261 bp
ATGAAGAGTGCTTTGGAATCTAATCAACCCAAAAAGAAAGGTCCATACAAGAGAAAAGCTTTTAAAGAATCCAATTCAAATGCATATGAGATGAACGGACCATCAACAAGATATGCACAAACTCAGGAAAACATTCAACCAATACCTCTGGTAATTGTTGTTGTAGTCAATCATACAAAGAGCAAGGAGAGCTGGCAAAATCCCATAACTAAGATGAACGAGCTTTTGCTAGCAGTGAACGATGCCACGCTATCGGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

9.69

Weight (kDa)

9.48

Isoelectric Point (pI)

30.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 78, 137
AjuI GAANNNNNNNTTGG 1 cut(s) 28
AluBI AGCT 3 cut(s) 59, 192, 223
AluI AGCT 3 cut(s) 59, 192, 223
Asp700I GAANNNNTTC 1 cut(s) 132
AspS9I GGNCC 2 cut(s) 41, 98
AsuNHI GCTAGC 1 cut(s) 229
AvaII GGWCC 2 cut(s) 41, 98
BccI CCATC 1 cut(s) 109
BfaI CTAG 1 cut(s) 230
Bme18I GGWCC 2 cut(s) 41, 98
BmgT120I GGNCC 2 cut(s) 41, 98
BmsI GCATC 1 cut(s) 232
BmtI GCTAGC 1 cut(s) 233
BseMII CTCAG 1 cut(s) 137
BspCNI CTCAG 1 cut(s) 136
BspOI GCTAGC 1 cut(s) 233
BstC8I GCNNGC 2 cut(s) 194, 231
BstDEI CTNAG 2 cut(s) 123, 210
BstMWI GCNNNNNNNGC 1 cut(s) 189
BtsI GCAGTG 1 cut(s) 240
BtsIMutI CAGTG 1 cut(s) 240
Cac8I GCNNGC 2 cut(s) 194, 231
Cfr13I GGNCC 2 cut(s) 41, 98
CviJI RGCY 3 cut(s) 59, 192, 223
CviKI_1 RGCY 3 cut(s) 59, 192, 223
DdeI CTNAG 2 cut(s) 123, 210
DraI TTTAAA 1 cut(s) 64
Eco47I GGWCC 2 cut(s) 41, 98
EcoT22I ATGCAT 1 cut(s) 85
FaiI YATR 6 cut(s) 46, 85, 87, 114, 174, 206
FauNDI CATATG 1 cut(s) 85
FspBI CTAG 1 cut(s) 230
HindIII AAGCTT 1 cut(s) 57
HinfI GANTC 2 cut(s) 17, 68
Hpy166II GTNNAC 1 cut(s) 238
Hpy188I TCNGA 1 cut(s) 256
Hpy188III TCNNGA 1 cut(s) 125
Hpy8I GTNNAC 1 cut(s) 238
HpyCH4V TGCA 2 cut(s) 83, 116
HpyF10VI GCNNNNNNNGC 1 cut(s) 189
HpyF3I CTNAG 2 cut(s) 123, 210
LpnPI CCDG 3 cut(s) 110, 134, 178
LweI GCATC 1 cut(s) 232
MaeI CTAG 1 cut(s) 230
MboII GAAGA 1 cut(s) 16
MluCI AATT 2 cut(s) 73, 153
MnlI CCTC 1 cut(s) 156
Mph1103I ATGCAT 1 cut(s) 85
MroXI GAANNNNTTC 1 cut(s) 132
MseI TTAA 1 cut(s) 63
MwoI GCNNNNNNNGC 1 cut(s) 189
NdeI CATATG 1 cut(s) 85
NheI GCTAGC 1 cut(s) 229
NsiI ATGCAT 1 cut(s) 85
PdmI GAANNNNTTC 1 cut(s) 132
PfeI GAWTC 2 cut(s) 17, 68
PspPI GGNCC 2 cut(s) 41, 98
SaqAI TTAA 1 cut(s) 63
Sau96I GGNCC 2 cut(s) 41, 98
SetI ASST 5 cut(s) 43, 61, 148, 194, 225
SfaNI GCATC 1 cut(s) 232
SgeI CNNG 8 cut(s) 61, 120, 137, 161, 196, 205, 232, 242
SinI GGWCC 2 cut(s) 41, 98
Sse9I AATT 2 cut(s) 73, 153
SspMI CTAG 1 cut(s) 230
TasI AATT 2 cut(s) 73, 153
TfiI GAWTC 2 cut(s) 17, 68
Tru1I TTAA 1 cut(s) 63
Tru9I TTAA 1 cut(s) 63
TscAI CASTG 1 cut(s) 240
TspDTI ATGAA 3 cut(s) 17, 107, 230
TspGWI ACGGA 1 cut(s) 111
TspRI CASTG 1 cut(s) 240
VpaK11BI GGWCC 2 cut(s) 41, 98
XmnI GAANNNNTTC 1 cut(s) 132
XspI CTAG 1 cut(s) 230
Zsp2I ATGCAT 1 cut(s) 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.