pycom17g27550

Ubiquitin-conjugating enzyme E2, catalytic domain homologues

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
N/A
Physical Location & Seq
Forward (+)
25684052 .. 25684378
327 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 327 bp
ATGGACTTTTATGGGATTTATAGTTATTATAGGTTCCAAGAGACGTTCAAACCATCGATCCCGATCGTGAAGGAGTGGGAGTTTAAGTCCAAACCAACACCAAAGCTTAATCATGGGGAGCTTGGGGAAGAAGCATTGGAAGAACGTCCAACATCGTCGAAGTTTTACGGGGAAATTGAAGAAATAAAAGAGACGTCGTCGAAGTTTTATGGAGAAATTGAAGAAATAAAAGATAGGGTGGAGAGGAGGTTCCATGAGTTCAAGAACTTTTCGATGAGTGCTTACCCTCCTTATCGATCATTACTTCCGCGAGAAGCCGTTTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

109

Amino Acids

12.98

Weight (kDa)

5.51

Isoelectric Point (pI)

51.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 325
AatII GACGTC 1 cut(s) 197
AccII CGCG 1 cut(s) 310
AciI CCGC 1 cut(s) 308
AclWI GGATC 1 cut(s) 52
AcyI GRCGYC 1 cut(s) 194
AgsI TTSAA 4 cut(s) 49, 179, 221, 262
AloI GAACNNNNNNTCC 2 cut(s) 233, 265
AluBI AGCT 2 cut(s) 106, 121
AluI AGCT 2 cut(s) 106, 121
Alw26I GTCTC 2 cut(s) 35, 185
AlwI GGATC 1 cut(s) 52
BccI CCATC 1 cut(s) 61
BceAI ACGGC 1 cut(s) 302
BcoDI GTCTC 2 cut(s) 35, 185
BmiI GGNNCC 2 cut(s) 35, 251
Bsa29I ATCGAT 2 cut(s) 56, 295
BsaBI GATNNNNATC 1 cut(s) 62
BsaHI GRCGYC 1 cut(s) 194
BsaXI ACNNNNNCTCC 6 cut(s) 65, 71, 95, 101, 233, 263
Bse8I GATNNNNATC 1 cut(s) 62
BseCI ATCGAT 2 cut(s) 56, 295
BseJI GATNNNNATC 1 cut(s) 62
BseRI GAGGAG 1 cut(s) 259
Bsh1236I CGCG 1 cut(s) 310
Bsh1285I CGRYCG 1 cut(s) 66
BshVI ATCGAT 2 cut(s) 56, 295
BsiEI CGRYCG 1 cut(s) 66
BsmAI GTCTC 2 cut(s) 35, 185
BsmBI CGTCTC 2 cut(s) 35, 185
Bsp143I GATC 3 cut(s) 57, 63, 296
BspACI CCGC 1 cut(s) 308
BspDI ATCGAT 2 cut(s) 56, 295
BspFNI CGCG 1 cut(s) 310
BspLI GGNNCC 2 cut(s) 35, 251
BspPI GGATC 1 cut(s) 52
BssMI GATC 3 cut(s) 57, 63, 296
BssNI GRCGYC 1 cut(s) 194
BstACI GRCGYC 1 cut(s) 194
BstFNI CGCG 1 cut(s) 310
BstKTI GATC 3 cut(s) 60, 66, 299
BstMAI GTCTC 2 cut(s) 35, 185
BstMBI GATC 3 cut(s) 57, 63, 296
BstMCI CGRYCG 1 cut(s) 66
BstUI CGCG 1 cut(s) 310
Bsu15I ATCGAT 2 cut(s) 56, 295
BsuTUI ATCGAT 2 cut(s) 56, 295
ClaI ATCGAT 2 cut(s) 56, 295
CviAII CATG 2 cut(s) 113, 254
CviJI RGCY 3 cut(s) 106, 121, 317
CviKI_1 RGCY 3 cut(s) 106, 121, 317
DpnI GATC 3 cut(s) 59, 65, 298
DpnII GATC 3 cut(s) 57, 63, 296
Esp3I CGTCTC 2 cut(s) 35, 185
FaeI CATG 2 cut(s) 116, 257
FaiI YATR 7 cut(s) 12, 21, 30, 114, 210, 255, 325
FatI CATG 2 cut(s) 112, 253
Hin1I GRCGYC 1 cut(s) 194
Hin1II CATG 2 cut(s) 116, 257
HindIII AAGCTT 1 cut(s) 104
Hpy188III TCNNGA 3 cut(s) 61, 67, 262
Hpy99I CGWCG 3 cut(s) 160, 199, 202
HpyAV CCTTC 1 cut(s) 64
HpyCH4IV ACGT 3 cut(s) 44, 145, 194
HpySE526I ACGT 3 cut(s) 44, 145, 194
Hsp92I GRCGYC 1 cut(s) 194
Hsp92II CATG 2 cut(s) 116, 257
Kzo9I GATC 3 cut(s) 57, 63, 296
LmnI GCTCC 1 cut(s) 118
MaeII ACGT 3 cut(s) 44, 145, 194
MalI GATC 3 cut(s) 59, 65, 298
MboI GATC 3 cut(s) 57, 63, 296
MboII GAAGA 4 cut(s) 140, 152, 191, 233
MluCI AATT 2 cut(s) 174, 216
MmeI TCCRAC 1 cut(s) 173
MnlI CCTC 3 cut(s) 237, 240, 297
MseI TTAA 2 cut(s) 84, 108
MvnI CGCG 1 cut(s) 310
NdeII GATC 3 cut(s) 57, 63, 296
NlaIII CATG 2 cut(s) 116, 257
NlaIV GGNNCC 2 cut(s) 35, 251
PflFI GACNNNGTC 1 cut(s) 196
Ple19I CGATCG 1 cut(s) 66
PsiI TTATAA 1 cut(s) 325
PspN4I GGNNCC 2 cut(s) 35, 251
PsyI GACNNNGTC 1 cut(s) 196
PvuI CGATCG 1 cut(s) 66
SaqAI TTAA 2 cut(s) 84, 108
Sau3AI GATC 3 cut(s) 57, 63, 296
SetI ASST 7 cut(s) 35, 47, 108, 123, 148, 197, 251
Sse9I AATT 2 cut(s) 174, 216
SsiI CCGC 1 cut(s) 308
TaiI ACGT 3 cut(s) 47, 148, 197
TaqI TCGA 5 cut(s) 56, 158, 200, 272, 295
TasI AATT 2 cut(s) 174, 216
Tru1I TTAA 2 cut(s) 84, 108
Tru9I TTAA 2 cut(s) 84, 108
Tth111I GACNNNGTC 1 cut(s) 196
ZraI GACGTC 1 cut(s) 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.