pycom420g00890

LURP-one-related 5-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
SuperScaffold_420
N/A
Physical Location & Seq
Reverse (-)
1188988 .. 1190188
1201 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 222 bp
ATGTTAGAAAAATATAACCGTTTGAATTTCAAAGGATGTTACGGTTGGATTTTCTGCAAATCCAAGGGAAGGGGTTTTCTTTCCGATTGGGTCTTTTCGATTCAGAACATTAACCAACAAAACATGCTTCTGGGTTATAATTTCATCAATGTTGCAACTGATATGATCAATTTGAATGGTTATTCCGCTGCGCTATTTCATAAATTGGATCTGTGCAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.52

Weight (kDa)

9.15

Isoelectric Point (pI)

4.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 138
AciI CCGC 1 cut(s) 186
AclWI GGATC 1 cut(s) 216
AcsI RAATTY 1 cut(s) 25
AfiI CCNNNNNNNGG 1 cut(s) 69
AgsI TTSAA 3 cut(s) 25, 31, 175
AlwI GGATC 1 cut(s) 216
ApeKI GCWGC 1 cut(s) 188
ApoI RAATTY 1 cut(s) 25
AspLEI GCGC 1 cut(s) 193
BbvI GCAGC 1 cut(s) 175
BclI TGATCA 1 cut(s) 165
BisI GCNGC 1 cut(s) 189
BlsI GCNGC 1 cut(s) 190
BsaJI CCNNGG 1 cut(s) 63
Bsc4I CCNNNNNNNGG 1 cut(s) 69
BseDI CCNNGG 1 cut(s) 63
BseGI GGATG 1 cut(s) 41
BseLI CCNNNNNNNGG 1 cut(s) 69
BseXI GCAGC 1 cut(s) 175
BslI CCNNNNNNNGG 1 cut(s) 69
Bsp143I GATC 2 cut(s) 165, 208
BspACI CCGC 1 cut(s) 186
BspPI GGATC 1 cut(s) 216
BssECI CCNNGG 1 cut(s) 63
BssMI GATC 2 cut(s) 165, 208
BssT1I CCWWGG 1 cut(s) 63
Bst4CI ACNGT 2 cut(s) 20, 44
BstF5I GGATG 1 cut(s) 41
BstHHI GCGC 1 cut(s) 193
BstKTI GATC 2 cut(s) 168, 211
BstMBI GATC 2 cut(s) 165, 208
BstNSI RCATGY 1 cut(s) 127
BstV1I GCAGC 1 cut(s) 175
BstX2I RGATCY 1 cut(s) 208
BstYI RGATCY 1 cut(s) 208
BtsCI GGATG 1 cut(s) 41
CfoI GCGC 1 cut(s) 193
CviAII CATG 1 cut(s) 124
DpnI GATC 2 cut(s) 167, 210
DpnII GATC 2 cut(s) 165, 208
Eco130I CCWWGG 1 cut(s) 63
EcoT14I CCWWGG 1 cut(s) 63
ErhI CCWWGG 1 cut(s) 63
FaeI CATG 1 cut(s) 127
FaiI YATR 5 cut(s) 15, 125, 138, 164, 201
FatI CATG 1 cut(s) 123
FbaI TGATCA 1 cut(s) 165
Fnu4HI GCNGC 1 cut(s) 189
FokI GGATG 1 cut(s) 48
Fsp4HI GCNGC 1 cut(s) 189
GlaI GCGC 1 cut(s) 192
GluI GCNGC 1 cut(s) 189
HhaI GCGC 1 cut(s) 193
Hin1II CATG 1 cut(s) 127
Hin6I GCGC 1 cut(s) 191
HinP1I GCGC 1 cut(s) 191
HinfI GANTC 1 cut(s) 100
Hpy188I TCNGA 2 cut(s) 85, 105
HpyAV CCTTC 1 cut(s) 63
HpyCH4III ACNGT 2 cut(s) 20, 44
HpyCH4V TGCA 3 cut(s) 57, 155, 216
Hsp92II CATG 1 cut(s) 127
HspAI GCGC 1 cut(s) 191
Ksp22I TGATCA 1 cut(s) 165
Kzo9I GATC 2 cut(s) 165, 208
LpnPI CCDG 1 cut(s) 116
Lsp1109I GCAGC 1 cut(s) 175
MaeIII GTNAC 1 cut(s) 38
MalI GATC 2 cut(s) 167, 210
MboI GATC 2 cut(s) 165, 208
MflI RGATCY 1 cut(s) 208
MluCI AATT 4 cut(s) 25, 139, 169, 203
MmeI TCCRAC 1 cut(s) 26
MseI TTAA 1 cut(s) 111
MspA1I CMGCKG 1 cut(s) 188
NdeII GATC 2 cut(s) 165, 208
NlaIII CATG 1 cut(s) 127
NspI RCATGY 1 cut(s) 127
PfeI GAWTC 1 cut(s) 100
PkrI GCNGC 1 cut(s) 190
PsiI TTATAA 1 cut(s) 138
PsuI RGATCY 1 cut(s) 208
SaqAI TTAA 1 cut(s) 111
SatI GCNGC 1 cut(s) 189
Sau3AI GATC 2 cut(s) 165, 208
SgeI CNNG 3 cut(s) 76, 136, 143
Sse9I AATT 4 cut(s) 25, 139, 169, 203
SsiI CCGC 1 cut(s) 186
StyI CCWWGG 1 cut(s) 63
TaaI ACNGT 2 cut(s) 20, 44
TaqI TCGA 1 cut(s) 98
TasI AATT 4 cut(s) 25, 139, 169, 203
TfiI GAWTC 1 cut(s) 100
Tru1I TTAA 1 cut(s) 111
Tru9I TTAA 1 cut(s) 111
TseI GCWGC 1 cut(s) 188
TspDTI ATGAA 2 cut(s) 133, 188
XapI RAATTY 1 cut(s) 25
XceI RCATGY 1 cut(s) 127
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.