pycom5153684g00320

isoprenylcysteine alpha-carbonyl methylesterase

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012527_4311101_to_5153684
Physical Location & Seq
Forward (+)
503033 .. 503339
307 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 228 bp
ATGATTCAAGACCAGAATGTTAGAAATGCTACTTCTCTTCTACCTCTTATTATTTTGTTTCATGCTATTGCAGATTACTTCATGCCATCAGATTTCAAGTATACCAACTTGGAATTTATCGAGAGCAACGTTGTAGAGGATGATGGAAACTCTATAAAAAACAACTGTTGGAAGGAGGTAACGTCTGAGGAGAGAATGTTTTGCTTTTGGTTTTTTATTATCAAATGA

Protein Analysis

76

Amino Acids

8.93

Weight (kDa)

4.53

Isoelectric Point (pI)

36.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029419)

Species Orthologous Gene IDs
pyrus_communis pycom12g02870 pycom5153684g00320

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 101
AclI AACGTT 1 cut(s) 129
AcsI RAATTY 1 cut(s) 113
AgsI TTSAA 2 cut(s) 8, 97
ApoI RAATTY 1 cut(s) 113
BccI CCATC 2 cut(s) 94, 137
BsaXI ACNNNNNCTCC 4 cut(s) 167, 182, 197, 212
BseGI GGATG 1 cut(s) 145
BseMII CTCAG 1 cut(s) 177
BseRI GAGGAG 1 cut(s) 203
BspCNI CTCAG 1 cut(s) 178
BssNAI GTATAC 1 cut(s) 102
Bst1107I GTATAC 1 cut(s) 102
Bst4CI ACNGT 1 cut(s) 167
Bst6I CTCTTC 1 cut(s) 42
BstDEI CTNAG 1 cut(s) 186
BstF5I GGATG 1 cut(s) 145
BstZ17I GTATAC 1 cut(s) 102
BtsCI GGATG 1 cut(s) 145
CviAII CATG 2 cut(s) 62, 82
DdeI CTNAG 1 cut(s) 186
Eam1104I CTCTTC 1 cut(s) 42
EarI CTCTTC 1 cut(s) 42
FaeI CATG 2 cut(s) 65, 85
FaiI YATR 4 cut(s) 63, 83, 102, 155
FatI CATG 2 cut(s) 61, 81
FblI GTMKAC 1 cut(s) 101
FokI GGATG 1 cut(s) 152
Hin1II CATG 2 cut(s) 65, 85
HinfI GANTC 1 cut(s) 4
Hpy166II GTNNAC 1 cut(s) 102
Hpy188I TCNGA 2 cut(s) 91, 187
Hpy188III TCNNGA 2 cut(s) 8, 121
Hpy8I GTNNAC 1 cut(s) 102
HpyAV CCTTC 1 cut(s) 166
HpyCH4III ACNGT 1 cut(s) 167
HpyCH4IV ACGT 2 cut(s) 129, 182
HpyCH4V TGCA 1 cut(s) 71
HpyF3I CTNAG 1 cut(s) 186
HpySE526I ACGT 2 cut(s) 129, 182
Hsp92II CATG 2 cut(s) 65, 85
LpnPI CCDG 1 cut(s) 26
MaeII ACGT 2 cut(s) 129, 182
MaeIII GTNAC 1 cut(s) 178
MboII GAAGA 1 cut(s) 29
MluCI AATT 1 cut(s) 113
MmeI TCCRAC 1 cut(s) 149
MnlI CCTC 4 cut(s) 54, 130, 169, 181
NlaIII CATG 2 cut(s) 65, 85
PcsI WCGNNNNNNNCGW 1 cut(s) 126
PfeI GAWTC 1 cut(s) 4
Psp1406I AACGTT 1 cut(s) 129
SetI ASST 4 cut(s) 46, 132, 180, 185
SgeI CNNG 7 cut(s) 20, 25, 74, 94, 109, 121, 133
Sse9I AATT 1 cut(s) 113
TaaI ACNGT 1 cut(s) 167
TaiI ACGT 2 cut(s) 132, 185
TaqI TCGA 1 cut(s) 120
TasI AATT 1 cut(s) 113
TfiI GAWTC 1 cut(s) 4
TspDTI ATGAA 2 cut(s) 50, 70
XapI RAATTY 1 cut(s) 113
XmiI GTMKAC 1 cut(s) 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.