pycom675g00010

Belongs to the cytochrome P450 family

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00000675
N/A
Physical Location & Seq
Forward (+)
8976 .. 11186
2211 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 225 bp
ATGCAACTTTTACAACCAACCCAGCAGCAGACCCAACACCTTCTTCTCAACTTTCTCAGAAAATCAATGGCACCCATGAACCAGATTCTCCAAGATTTCCAAGCAATGCACTTTTCAGTCGCTGCTACCATTGCTGCTTTGTTGTTCCTGTTTTCCGTCAAAGCTTCGATCTTCGCCAAGAAAAATGCTTTTTCCAAACTCGCTTATGTTCCAGGTGAAAAATGA

Protein Analysis

75

Amino Acids

8.35

Weight (kDa)

10.12

Isoelectric Point (pI)

36.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 70
AjnI CCWGG 1 cut(s) 211
AjuI GAANNNNNNNTTGG 2 cut(s) 27, 59
AluBI AGCT 1 cut(s) 164
AluI AGCT 1 cut(s) 164
AlwNI CAGNNNCTG 1 cut(s) 122
ApeKI GCWGC 3 cut(s) 25, 122, 134
BanI GGYRCC 1 cut(s) 70
BbvI GCAGC 3 cut(s) 37, 109, 121
BciT130I CCWGG 1 cut(s) 213
BisI GCNGC 3 cut(s) 26, 123, 135
BlsI GCNGC 3 cut(s) 27, 124, 136
Bme1390I CCNGG 1 cut(s) 213
BmiI GGNNCC 1 cut(s) 72
BmrFI CCNGG 1 cut(s) 213
Bse3DI GCAATG 2 cut(s) 111, 129
BseBI CCWGG 1 cut(s) 213
BseMI GCAATG 2 cut(s) 111, 129
BseMII CTCAG 1 cut(s) 70
BseXI GCAGC 3 cut(s) 37, 109, 121
BseYI CCCAGC 1 cut(s) 21
BshNI GGYRCC 1 cut(s) 70
Bsp143I GATC 1 cut(s) 168
BspCNI CTCAG 1 cut(s) 69
BspLI GGNNCC 1 cut(s) 72
BspT107I GGYRCC 1 cut(s) 70
BsrDI GCAATG 2 cut(s) 111, 129
BssMI GATC 1 cut(s) 168
Bst2UI CCWGG 1 cut(s) 213
BstDEI CTNAG 1 cut(s) 56
BstKTI GATC 1 cut(s) 171
BstMBI GATC 1 cut(s) 168
BstMWI GCNNNNNNNGC 1 cut(s) 131
BstNI CCWGG 1 cut(s) 213
BstSCI CCNGG 1 cut(s) 211
BstV1I GCAGC 3 cut(s) 37, 109, 121
CaiI CAGNNNCTG 1 cut(s) 122
CviAII CATG 1 cut(s) 76
CviJI RGCY 1 cut(s) 164
CviKI_1 RGCY 1 cut(s) 164
DdeI CTNAG 1 cut(s) 56
DpnI GATC 1 cut(s) 170
DpnII GATC 1 cut(s) 168
EcoRII CCWGG 1 cut(s) 211
FaeI CATG 1 cut(s) 79
FaiI YATR 2 cut(s) 77, 207
FatI CATG 1 cut(s) 75
Fnu4HI GCNGC 3 cut(s) 26, 123, 135
Fsp4HI GCNGC 3 cut(s) 26, 123, 135
GluI GCNGC 3 cut(s) 26, 123, 135
GsaI CCCAGC 1 cut(s) 25
Hin1II CATG 1 cut(s) 79
HindIII AAGCTT 1 cut(s) 162
HinfI GANTC 1 cut(s) 85
Hpy188I TCNGA 1 cut(s) 59
HpyAV CCTTC 1 cut(s) 50
HpyCH4V TGCA 2 cut(s) 4, 109
HpyF10VI GCNNNNNNNGC 1 cut(s) 131
HpyF3I CTNAG 1 cut(s) 56
Hsp92II CATG 1 cut(s) 79
Kzo9I GATC 1 cut(s) 168
LpnPI CCDG 4 cut(s) 35, 95, 161, 198
Lsp1109I GCAGC 3 cut(s) 37, 109, 121
MalI GATC 1 cut(s) 170
MboI GATC 1 cut(s) 168
MboII GAAGA 2 cut(s) 35, 163
MspR9I CCNGG 1 cut(s) 213
MvaI CCWGG 1 cut(s) 213
MwoI GCNNNNNNNGC 1 cut(s) 131
NdeII GATC 1 cut(s) 168
NlaIII CATG 1 cut(s) 79
NlaIV GGNNCC 1 cut(s) 72
PfeI GAWTC 1 cut(s) 85
PkrI GCNGC 3 cut(s) 27, 124, 136
Psp6I CCWGG 1 cut(s) 211
PspFI CCCAGC 1 cut(s) 21
PspGI CCWGG 1 cut(s) 211
PspN4I GGNNCC 1 cut(s) 72
PstNI CAGNNNCTG 1 cut(s) 122
SatI GCNGC 3 cut(s) 26, 123, 135
Sau3AI GATC 1 cut(s) 168
ScrFI CCNGG 1 cut(s) 213
SetI ASST 3 cut(s) 42, 166, 217
SgeI CNNG 8 cut(s) 34, 88, 94, 104, 113, 160, 190, 212
StyD4I CCNGG 1 cut(s) 211
TaqI TCGA 1 cut(s) 167
TfiI GAWTC 1 cut(s) 85
TseI GCWGC 3 cut(s) 25, 122, 134
TspDTI ATGAA 1 cut(s) 92
TspGWI ACGGA 1 cut(s) 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.