pycom854g00040

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00000854
N/A
Physical Location & Seq
Forward (+)
50582 .. 51332
751 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 462 bp
ATGACTGTTTGGTTATTTCGTCTCCAGAGGCCCGATAGTTCTTTCTTTCACGATCCTTTCGTAGTTCCGCCAGCTTTGAATAATTTGATCGGTGAGACAAAACATATCCAGCTCTCTTTTGGAAATCAAAACATTGATTTTGGGAAGACTGACTTCATCGCTCATGGACTACAAAACCAACCTCTCTCAAGCCCAACAATTGCCTTAGTCACACCACATACACCTGCTACCACCACAGGAAAACAAATTATGACTGAAGCAACCCCCAGCCTATTGACACCTTCCCATTATGCCTTGATTCACAGTCAAAAACCTCGCAACGACCAAACAAAGACAACCAATTCTGCCAAAATTGCTAGAGAATTTCACAATCTGGTTGTCCCCAAAATTGAACCAGCAGACAAAGTGCCGATAGCCACACTCAGAACAAAATCTCAAATCAAAAAAACCAAAGAAAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

154

Amino Acids

17.1

Weight (kDa)

9.93

Isoelectric Point (pI)

47.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 232
Acc36I ACCTGC 1 cut(s) 232
AciI CCGC 1 cut(s) 68
AclWI GGATC 1 cut(s) 47
AcsI RAATTY 1 cut(s) 362
AcuI CTGAAG 1 cut(s) 276
AfiI CCNNNNNNNGG 1 cut(s) 456
AgsI TTSAA 2 cut(s) 79, 392
AluBI AGCT 2 cut(s) 74, 112
AluI AGCT 2 cut(s) 74, 112
Alw26I GTCTC 2 cut(s) 26, 89
AlwI GGATC 1 cut(s) 47
AoxI GGCC 1 cut(s) 29
ApoI RAATTY 1 cut(s) 362
AspS9I GGNCC 1 cut(s) 30
AsuHPI GGTGA 1 cut(s) 104
BbsI GAAGAC 1 cut(s) 152
BcoDI GTCTC 2 cut(s) 26, 89
BfaI CTAG 1 cut(s) 357
BfuAI ACCTGC 1 cut(s) 232
BmgT120I GGNCC 1 cut(s) 30
BpiI GAAGAC 1 cut(s) 152
BpmI CTGGAG 1 cut(s) 8
BpuEI CTTGAG 1 cut(s) 172
Bsc4I CCNNNNNNNGG 1 cut(s) 456
BseLI CCNNNNNNNGG 1 cut(s) 456
BseMII CTCAG 1 cut(s) 436
BseYI CCCAGC 1 cut(s) 266
BshFI GGCC 1 cut(s) 31
BslFI GGGAC 1 cut(s) 365
BslI CCNNNNNNNGG 1 cut(s) 456
BsmAI GTCTC 2 cut(s) 26, 89
BsmBI CGTCTC 1 cut(s) 26
BsmFI GGGAC 1 cut(s) 365
BsnI GGCC 1 cut(s) 31
Bsp143I GATC 2 cut(s) 52, 87
BspACI CCGC 1 cut(s) 68
BspANI GGCC 1 cut(s) 31
BspCNI CTCAG 1 cut(s) 435
BspMI ACCTGC 1 cut(s) 232
BspPI GGATC 1 cut(s) 47
BssMI GATC 2 cut(s) 52, 87
Bst4CI ACNGT 2 cut(s) 7, 305
BstC8I GCNNGC 1 cut(s) 72
BstDEI CTNAG 2 cut(s) 205, 422
BstKTI GATC 2 cut(s) 55, 90
BstMAI GTCTC 2 cut(s) 26, 89
BstMBI GATC 2 cut(s) 52, 87
BstMWI GCNNNNNNNGC 1 cut(s) 353
BstV2I GAAGAC 1 cut(s) 152
BsuRI GGCC 1 cut(s) 31
BtgZI GCGATG 1 cut(s) 142
BveI ACCTGC 1 cut(s) 232
Cac8I GCNNGC 1 cut(s) 72
Cfr13I GGNCC 1 cut(s) 30
CviAII CATG 1 cut(s) 164
CviJI RGCY 6 cut(s) 31, 74, 112, 192, 270, 416
CviKI_1 RGCY 6 cut(s) 31, 74, 112, 192, 270, 416
DdeI CTNAG 2 cut(s) 205, 422
DpnI GATC 2 cut(s) 54, 89
DpnII GATC 2 cut(s) 52, 87
EciI GGCGGA 1 cut(s) 57
Eco57I CTGAAG 1 cut(s) 276
Esp3I CGTCTC 1 cut(s) 26
FaeI CATG 1 cut(s) 167
FaiI YATR 5 cut(s) 105, 165, 219, 251, 291
FalI AAGNNNNNCTT 2 cut(s) 137, 169
FaqI GGGAC 1 cut(s) 365
FatI CATG 1 cut(s) 163
FspBI CTAG 1 cut(s) 357
GsaI CCCAGC 1 cut(s) 270
GsuI CTGGAG 1 cut(s) 8
HaeIII GGCC 1 cut(s) 31
Hin1II CATG 1 cut(s) 167
HinfI GANTC 1 cut(s) 298
HphI GGTGA 1 cut(s) 104
Hpy188I TCNGA 1 cut(s) 425
Hpy188III TCNNGA 2 cut(s) 25, 50
HpyAV CCTTC 1 cut(s) 291
HpyCH4III ACNGT 2 cut(s) 7, 305
HpyF10VI GCNNNNNNNGC 1 cut(s) 353
HpyF3I CTNAG 2 cut(s) 205, 422
Hsp92II CATG 1 cut(s) 167
Kzo9I GATC 2 cut(s) 52, 87
LpnPI CCDG 8 cut(s) 38, 84, 122, 222, 237, 280, 359, 408
MaeI CTAG 1 cut(s) 357
MaeIII GTNAC 1 cut(s) 208
MalI GATC 2 cut(s) 54, 89
MboI GATC 2 cut(s) 52, 87
MboII GAAGA 1 cut(s) 157
MfeI CAATTG 1 cut(s) 198
MluCI AATT 7 cut(s) 82, 198, 246, 340, 351, 362, 387
MnlI CCTC 3 cut(s) 21, 192, 324
MunI CAATTG 1 cut(s) 198
MwoI GCNNNNNNNGC 1 cut(s) 353
NdeII GATC 2 cut(s) 52, 87
NlaIII CATG 1 cut(s) 167
NmuCI GTSAC 1 cut(s) 208
PaqCI CACCTGC 1 cut(s) 232
PcsI WCGNNNNNNNCGW 1 cut(s) 57
PfeI GAWTC 1 cut(s) 298
PspFI CCCAGC 1 cut(s) 266
PspPI GGNCC 1 cut(s) 30
Sau3AI GATC 2 cut(s) 52, 87
Sau96I GGNCC 1 cut(s) 30
SetI ASST 7 cut(s) 76, 114, 184, 226, 283, 316, 461
SmlI CTYRAG 1 cut(s) 187
SmoI CTYRAG 1 cut(s) 187
Sse9I AATT 7 cut(s) 82, 198, 246, 340, 351, 362, 387
SsiI CCGC 1 cut(s) 68
SspMI CTAG 1 cut(s) 357
TaaI ACNGT 2 cut(s) 7, 305
TasI AATT 7 cut(s) 82, 198, 246, 340, 351, 362, 387
TfiI GAWTC 1 cut(s) 298
TseFI GTSAC 1 cut(s) 208
Tsp45I GTSAC 1 cut(s) 208
TspDTI ATGAA 1 cut(s) 145
XapI RAATTY 1 cut(s) 362
XcmI CCANNNNNNNNNTGG 1 cut(s) 116
XspI CTAG 1 cut(s) 357
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.