RchiOBHm_Chr7g0178291

S-adenosylmethionine-dependent methyltransferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
N/A
Physical Location & Seq
Reverse (-)
998651 .. 998884
234 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 222 bp
ATGGCAGAGTTACCTCGTCCCTTGGTACACGACACTCTTTCAATATCCCCGATGATTGCTTCTCACGTAAGAGCTGCTATGGAGGGGATGATAAAGAAGCAATTTGGAGAAGAAATCTTAGATGAGCTTTTCGACTTGTACCGACAAAAATGTGAGCAATCAGTACTTAACACACTGCTTGGAGACACCTTTCTTGTTGTTCTTAGACGTAAAGCAGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Methyltransf_7

Protein Analysis

73

Amino Acids

8.33

Weight (kDa)

5.6

Isoelectric Point (pI)

46.94

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Methyltransf_7 PF03492 17 - 58 2.9e-08 SAM dependent carboxyl methyltransferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 3 cut(s) 27, 140, 165
AgsI TTSAA 1 cut(s) 42
AluBI AGCT 2 cut(s) 74, 127
AluI AGCT 2 cut(s) 74, 127
Alw26I GTCTC 1 cut(s) 177
ApeKI GCWGC 1 cut(s) 74
BbvI GCAGC 1 cut(s) 61
BcoDI GTCTC 1 cut(s) 177
BisI GCNGC 1 cut(s) 75
BlsI GCNGC 1 cut(s) 76
BmcAI AGTACT 1 cut(s) 165
BsaAI YACGTR 1 cut(s) 67
BsaJI CCNNGG 1 cut(s) 21
BseDI CCNNGG 1 cut(s) 21
BseGI GGATG 1 cut(s) 93
BseXI GCAGC 1 cut(s) 61
BslFI GGGAC 1 cut(s) 3
BsmAI GTCTC 1 cut(s) 177
BsmFI GGGAC 1 cut(s) 3
BssECI CCNNGG 1 cut(s) 21
BssT1I CCWWGG 1 cut(s) 21
BstBAI YACGTR 1 cut(s) 67
BstDEI CTNAG 2 cut(s) 118, 203
BstF5I GGATG 1 cut(s) 93
BstMAI GTCTC 1 cut(s) 177
BstV1I GCAGC 1 cut(s) 61
BtsCI GGATG 1 cut(s) 93
BtsI GCAGTG 1 cut(s) 173
BtsIMutI CAGTG 1 cut(s) 173
Csp6I GTAC 3 cut(s) 26, 139, 164
CviJI RGCY 2 cut(s) 74, 127
CviKI_1 RGCY 2 cut(s) 74, 127
CviQI GTAC 3 cut(s) 26, 139, 164
DdeI CTNAG 2 cut(s) 118, 203
Eco130I CCWWGG 1 cut(s) 21
EcoT14I CCWWGG 1 cut(s) 21
ErhI CCWWGG 1 cut(s) 21
FaiI YATR 1 cut(s) 80
FaqI GGGAC 1 cut(s) 3
Fnu4HI GCNGC 1 cut(s) 75
FokI GGATG 1 cut(s) 100
Fsp4HI GCNGC 1 cut(s) 75
GluI GCNGC 1 cut(s) 75
Hpy166II GTNNAC 1 cut(s) 28
Hpy8I GTNNAC 1 cut(s) 28
HpyCH4IV ACGT 2 cut(s) 66, 208
HpyF3I CTNAG 2 cut(s) 118, 203
HpySE526I ACGT 2 cut(s) 66, 208
Lsp1109I GCAGC 1 cut(s) 61
MaeII ACGT 2 cut(s) 66, 208
MaeIII GTNAC 1 cut(s) 9
MboII GAAGA 1 cut(s) 122
MluCI AATT 1 cut(s) 101
MnlI CCTC 2 cut(s) 24, 76
MseI TTAA 1 cut(s) 168
PkrI GCNGC 1 cut(s) 76
Ppu21I YACGTR 1 cut(s) 67
RsaI GTAC 3 cut(s) 27, 140, 165
RsaNI GTAC 3 cut(s) 26, 139, 164
SaqAI TTAA 1 cut(s) 168
SatI GCNGC 1 cut(s) 75
ScaI AGTACT 1 cut(s) 165
SetI ASST 6 cut(s) 16, 69, 76, 129, 191, 211
SgeI CNNG 8 cut(s) 27, 34, 41, 61, 77, 148, 191, 206
Sse9I AATT 1 cut(s) 101
StyI CCWWGG 1 cut(s) 21
TaiI ACGT 2 cut(s) 69, 211
TaqI TCGA 1 cut(s) 132
TasI AATT 1 cut(s) 101
TatI WGTACW 1 cut(s) 163
Tru1I TTAA 1 cut(s) 168
Tru9I TTAA 1 cut(s) 168
TscAI CASTG 1 cut(s) 180
TseI GCWGC 1 cut(s) 74
TspRI CASTG 1 cut(s) 180
ZrmI AGTACT 1 cut(s) 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.