RchiOBHm_Chr7g0180291

HIPL1 protein-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
N/A
Physical Location & Seq
Reverse (-)
2239969 .. 2240257
289 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 183 bp
ATGAAACATCCAGGCTGTTCAGGCAGATGTTCATGCAATACAGATGTGAATTGTGACCCTTCAAAGCTTTCTGCTGATAGTGGGGTGCAGCCCTGTCAATACCACAGTGTTGTTGCTGAATTTACAGTTAATGGTACAGCACCGGAGCCTTCCTTGCAAAAAGCTCAAATCCATCAGAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
GSDH

Protein Analysis

60

Amino Acids

6.39

Weight (kDa)

6.79

Isoelectric Point (pI)

37.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 119
AfaI GTAC 1 cut(s) 136
AgsI TTSAA 1 cut(s) 63
AjnI CCWGG 1 cut(s) 10
AluBI AGCT 2 cut(s) 67, 164
AluI AGCT 2 cut(s) 67, 164
ApeKI GCWGC 1 cut(s) 88
ApoI RAATTY 1 cut(s) 119
BbvI GCAGC 1 cut(s) 100
BccI CCATC 1 cut(s) 180
BciT130I CCWGG 1 cut(s) 12
BisI GCNGC 1 cut(s) 89
BlsI GCNGC 1 cut(s) 90
Bme1390I CCNGG 1 cut(s) 12
BmiI GGNNCC 1 cut(s) 147
BmrFI CCNGG 1 cut(s) 12
BsaWI WCCGGW 1 cut(s) 142
BseBI CCWGG 1 cut(s) 12
BseGI GGATG 1 cut(s) 7
BseXI GCAGC 1 cut(s) 100
BsgI GTGCAG 1 cut(s) 107
BsiSI CCGG 1 cut(s) 143
BspLI GGNNCC 1 cut(s) 147
Bst2UI CCWGG 1 cut(s) 12
Bst4CI ACNGT 2 cut(s) 107, 127
BstF5I GGATG 1 cut(s) 7
BstMWI GCNNNNNNNGC 2 cut(s) 21, 154
BstNI CCWGG 1 cut(s) 12
BstSCI CCNGG 1 cut(s) 10
BstV1I GCAGC 1 cut(s) 100
BtsCI GGATG 1 cut(s) 7
BtsIMutI CAGTG 1 cut(s) 112
Csp6I GTAC 1 cut(s) 135
CviAII CATG 1 cut(s) 33
CviJI RGCY 5 cut(s) 15, 67, 91, 148, 164
CviKI_1 RGCY 5 cut(s) 15, 67, 91, 148, 164
CviQI GTAC 1 cut(s) 135
EcoRII CCWGG 1 cut(s) 10
FaeI CATG 1 cut(s) 36
FaiI YATR 1 cut(s) 34
FatI CATG 1 cut(s) 32
Fnu4HI GCNGC 1 cut(s) 89
Fsp4HI GCNGC 1 cut(s) 89
GluI GCNGC 1 cut(s) 89
HapII CCGG 1 cut(s) 143
Hin1II CATG 1 cut(s) 36
HindIII AAGCTT 1 cut(s) 65
HpaII CCGG 1 cut(s) 143
Hpy188I TCNGA 1 cut(s) 177
HpyAV CCTTC 2 cut(s) 69, 159
HpyCH4III ACNGT 2 cut(s) 107, 127
HpyCH4V TGCA 3 cut(s) 36, 88, 157
HpyF10VI GCNNNNNNNGC 2 cut(s) 21, 154
Hsp92II CATG 1 cut(s) 36
LmnI GCTCC 1 cut(s) 145
LpnPI CCDG 4 cut(s) 6, 24, 106, 156
Lsp1109I GCAGC 1 cut(s) 100
MaeIII GTNAC 1 cut(s) 53
MluCI AATT 2 cut(s) 49, 119
MseI TTAA 1 cut(s) 129
MspI CCGG 1 cut(s) 143
MspR9I CCNGG 1 cut(s) 12
MvaI CCWGG 1 cut(s) 12
MwoI GCNNNNNNNGC 2 cut(s) 21, 154
NlaIII CATG 1 cut(s) 36
NlaIV GGNNCC 1 cut(s) 147
NmuCI GTSAC 1 cut(s) 53
PkrI GCNGC 1 cut(s) 90
Psp6I CCWGG 1 cut(s) 10
PspGI CCWGG 1 cut(s) 10
PspN4I GGNNCC 1 cut(s) 147
RsaI GTAC 1 cut(s) 136
RsaNI GTAC 1 cut(s) 135
SaqAI TTAA 1 cut(s) 129
SatI GCNGC 1 cut(s) 89
ScrFI CCNGG 1 cut(s) 12
SetI ASST 2 cut(s) 69, 166
SgeI CNNG 7 cut(s) 23, 24, 33, 45, 105, 155, 166
Sse9I AATT 2 cut(s) 49, 119
StyD4I CCNGG 1 cut(s) 10
TaaI ACNGT 2 cut(s) 107, 127
TasI AATT 2 cut(s) 49, 119
Tru1I TTAA 1 cut(s) 129
Tru9I TTAA 1 cut(s) 129
TscAI CASTG 1 cut(s) 112
TseFI GTSAC 1 cut(s) 53
TseI GCWGC 1 cut(s) 88
Tsp45I GTSAC 1 cut(s) 53
TspDTI ATGAA 2 cut(s) 17, 21
TspRI CASTG 1 cut(s) 112
XapI RAATTY 1 cut(s) 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.