RchiOBHm_Chr7g0226081

F-box kelch-repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
N/A
Physical Location & Seq
Reverse (-)
49118598 .. 49119442
845 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 387 bp
ATGAGGTTACCTCTAGGCAAACTGTATTCTGATTTTTTTAAAATGTTGGTAATCTGGAACCCATCCACTGGATTCGTCCGCAAAATACCTAGTCCAAGTTTTCAGATTGGGATGATAGAATTGACAGATGCAAGGAAAGAGACGCACATATACGAGGCATATTATGGTTTTGGTCAAGTGTTGCCCTCCGACGACTATAAACTTGTTGTGATGCCCAATGCTGGTTGTCTTATGCAAGTATACGTGTTCTCAGTCAGAGCCAACTGTTGGAAAGTTGTTAAAGCTCCTGACCTGTTGCGATCGCCCGTCTGGTCTACAGCATTGGGGACTTATTCAAATGGAGCAATTCATTGGGCCAGTTTTCGCAATCCTGAGACTTTCAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box F-box-like FBA_1

Protein Analysis

128

Amino Acids

14.62

Weight (kDa)

9.33

Isoelectric Point (pI)

39.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 68, 267
AccI GTMKAC 2 cut(s) 240, 314
AciI CCGC 1 cut(s) 79
AfiI CCNNNNNNNGG 3 cut(s) 68, 221, 267
AflIII ACRYGT 1 cut(s) 243
AgsI TTSAA 2 cut(s) 336, 382
AluBI AGCT 1 cut(s) 284
AluI AGCT 1 cut(s) 284
Alw26I GTCTC 2 cut(s) 134, 368
AoxI GGCC 1 cut(s) 354
AsiSI GCGATCGC 1 cut(s) 302
AspS9I GGNCC 1 cut(s) 354
BccI CCATC 1 cut(s) 70
BcoDI GTCTC 2 cut(s) 134, 368
BfaI CTAG 2 cut(s) 14, 90
BfmI CTRYAG 1 cut(s) 315
BmgT120I GGNCC 1 cut(s) 354
BmiI GGNNCC 1 cut(s) 59
BmsI GCATC 2 cut(s) 118, 201
BplI GAGNNNNNCTC 1 cut(s) 27
BsaAI YACGTR 1 cut(s) 244
Bsc4I CCNNNNNNNGG 3 cut(s) 68, 221, 267
Bse1I ACTGG 2 cut(s) 73, 357
BseGI GGATG 2 cut(s) 62, 117
BseLI CCNNNNNNNGG 3 cut(s) 68, 221, 267
BseMII CTCAG 2 cut(s) 264, 363
BseNI ACTGG 2 cut(s) 73, 357
Bsh1285I CGRYCG 1 cut(s) 302
BshFI GGCC 1 cut(s) 356
BsiEI CGRYCG 1 cut(s) 302
BslFI GGGAC 1 cut(s) 340
BslI CCNNNNNNNGG 3 cut(s) 68, 221, 267
BsmAI GTCTC 2 cut(s) 134, 368
BsmBI CGTCTC 1 cut(s) 134
BsmFI GGGAC 1 cut(s) 340
BsnI GGCC 1 cut(s) 356
Bsp143I GATC 1 cut(s) 299
BspACI CCGC 1 cut(s) 79
BspANI GGCC 1 cut(s) 356
BspCNI CTCAG 2 cut(s) 263, 364
BspLI GGNNCC 1 cut(s) 59
BsrI ACTGG 2 cut(s) 73, 357
BssMI GATC 1 cut(s) 299
BssNAI GTATAC 1 cut(s) 241
Bst1107I GTATAC 1 cut(s) 241
Bst4CI ACNGT 2 cut(s) 24, 266
BstBAI YACGTR 1 cut(s) 244
BstDEI CTNAG 2 cut(s) 250, 372
BstEII GGTNACC 1 cut(s) 6
BstF5I GGATG 2 cut(s) 62, 117
BstKTI GATC 1 cut(s) 302
BstMAI GTCTC 2 cut(s) 134, 368
BstMBI GATC 1 cut(s) 299
BstMCI CGRYCG 1 cut(s) 302
BstPI GGTNACC 1 cut(s) 6
BstSFI CTRYAG 1 cut(s) 315
BstZ17I GTATAC 1 cut(s) 241
BsuRI GGCC 1 cut(s) 356
BtsCI GGATG 2 cut(s) 62, 117
BtsIMutI CAGTG 1 cut(s) 66
Cfr13I GGNCC 1 cut(s) 354
CseI GACGC 1 cut(s) 151
CviJI RGCY 3 cut(s) 260, 284, 356
CviKI_1 RGCY 3 cut(s) 260, 284, 356
DdeI CTNAG 2 cut(s) 250, 372
DpnI GATC 1 cut(s) 301
DpnII GATC 1 cut(s) 299
DraI TTTAAA 1 cut(s) 40
Eco91I GGTNACC 1 cut(s) 6
EcoO65I GGTNACC 1 cut(s) 6
Esp3I CGTCTC 1 cut(s) 134
FaiI YATR 7 cut(s) 149, 151, 160, 165, 198, 233, 241
FaqI GGGAC 1 cut(s) 340
FblI GTMKAC 2 cut(s) 240, 314
FokI GGATG 2 cut(s) 49, 124
FspBI CTAG 2 cut(s) 14, 90
HaeIII GGCC 1 cut(s) 356
HgaI GACGC 1 cut(s) 151
HinfI GANTC 1 cut(s) 72
Hpy166II GTNNAC 2 cut(s) 241, 315
Hpy188I TCNGA 4 cut(s) 31, 105, 190, 257
Hpy188III TCNNGA 3 cut(s) 55, 287, 371
Hpy8I GTNNAC 2 cut(s) 241, 315
Hpy99I CGWCG 1 cut(s) 194
HpyCH4III ACNGT 2 cut(s) 24, 266
HpyCH4IV ACGT 1 cut(s) 243
HpyCH4V TGCA 2 cut(s) 131, 235
HpyF3I CTNAG 2 cut(s) 250, 372
HpySE526I ACGT 1 cut(s) 243
Kzo9I GATC 1 cut(s) 299
LmnI GCTCC 2 cut(s) 289, 341
LpnPI CCDG 7 cut(s) 40, 54, 207, 295, 300, 305, 370
LweI GCATC 2 cut(s) 118, 201
MaeI CTAG 2 cut(s) 14, 90
MaeII ACGT 1 cut(s) 243
MaeIII GTNAC 1 cut(s) 6
MalI GATC 1 cut(s) 301
MboI GATC 1 cut(s) 299
MluCI AATT 2 cut(s) 119, 345
MmeI TCCRAC 2 cut(s) 213, 248
MnlI CCTC 3 cut(s) 21, 148, 196
MseI TTAA 2 cut(s) 39, 279
NdeII GATC 1 cut(s) 299
NlaIV GGNNCC 1 cut(s) 59
PfeI GAWTC 1 cut(s) 72
PflMI CCANNNNNTGG 2 cut(s) 68, 267
Ple19I CGATCG 1 cut(s) 302
Ppu21I YACGTR 1 cut(s) 244
PspEI GGTNACC 1 cut(s) 6
PspN4I GGNNCC 1 cut(s) 59
PspPI GGNCC 1 cut(s) 354
PvuI CGATCG 1 cut(s) 302
RgaI GCGATCGC 1 cut(s) 302
SaqAI TTAA 2 cut(s) 39, 279
Sau3AI GATC 1 cut(s) 299
Sau96I GGNCC 1 cut(s) 354
SetI ASST 6 cut(s) 8, 13, 91, 246, 286, 294
SfaAI GCGATCGC 1 cut(s) 302
SfaNI GCATC 2 cut(s) 118, 201
SfcI CTRYAG 1 cut(s) 315
SgfI GCGATCGC 1 cut(s) 302
Sse9I AATT 2 cut(s) 119, 345
SsiI CCGC 1 cut(s) 79
SspMI CTAG 2 cut(s) 14, 90
TaaI ACNGT 2 cut(s) 24, 266
TaiI ACGT 1 cut(s) 246
TasI AATT 2 cut(s) 119, 345
TfiI GAWTC 1 cut(s) 72
Tru1I TTAA 2 cut(s) 39, 279
Tru9I TTAA 2 cut(s) 39, 279
TscAI CASTG 1 cut(s) 73
TspDTI ATGAA 1 cut(s) 338
TspRI CASTG 1 cut(s) 73
Van91I CCANNNNNTGG 2 cut(s) 68, 267
XmiI GTMKAC 2 cut(s) 240, 314
XspI CTAG 2 cut(s) 14, 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.