Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Reverse (-)

1549429 .. 1550587

Gene Structure 1159 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 153 bp

ATGGTGTACATTTATTTTCTTGTTCTTTCGGTGGTAAAGTATAGACGACAATTACCAAAACTATTTTGTAGGTATATCTTCGGTGCTCTTATCATCGCTAAATTATTGTCTGTCCCCATTGTGATGTCTTACCACACTCATGTTTTCATGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000030 GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006082 GO:0006629 GO:0006643 GO:0006664 GO:0006790 GO:0006950 GO:0007154 GO:0008150 GO:0008152 GO:0008194 GO:0008610 GO:0009058 GO:0009247 GO:0009267 GO:0009507 GO:0009526 GO:0009536 GO:0009605 GO:0009941 GO:0009987 GO:0009991 GO:0016036 GO:0016740 GO:0016757 GO:0016758 GO:0031667 GO:0031668 GO:0031669 GO:0031967 GO:0031975 GO:0033554 GO:0042594 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043436 GO:0044237 GO:0044238 GO:0044249 GO:0044255 GO:0044272 GO:0044281 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464 GO:0046467 GO:0046505 GO:0046506 GO:0050896 GO:0051716 GO:0070085 GO:0071496 GO:0071704 GO:0097502 GO:1901135 GO:1901137 GO:1901576 GO:1903509

KEGG Pathways

Metabolic & Signaling

ko00561 ko01100 map00561 map01100

Pfam Domains

Protein Families

Glyco_trans_1_4 Glyco_transf_4 Glycos_transf_1

Protein Analysis

50

Amino Acids

5.98

Weight (kDa)

10.01

Isoelectric Point (pI)

28.79

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfaI	GTAC	1 cut(s)	8
Alw21I	GWGCWC	1 cut(s)	88
Bbv12I	GWGCWC	1 cut(s)	88
BsiHKAI	GWGCWC	1 cut(s)	88
BslFI	GGGAC	1 cut(s)	98
BsmFI	GGGAC	1 cut(s)	98
Bsp1286I	GDGCHC	1 cut(s)	88
Bsp1407I	TGTACA	1 cut(s)	6
BsrGI	TGTACA	1 cut(s)	6
BstAUI	TGTACA	1 cut(s)	6
BtgZI	GCGATG	1 cut(s)	79
Csp6I	GTAC	1 cut(s)	7
CviAII	CATG	2 cut(s)	140, 148
CviQI	GTAC	1 cut(s)	7
FaeI	CATG	2 cut(s)	143, 151
FaiI	YATR	4 cut(s)	42, 75, 141, 149
FaqI	GGGAC	1 cut(s)	98
FatI	CATG	2 cut(s)	139, 147
FspEI	CC	9 cut(s)	14, 17, 55, 66, 69, 128, 129, 130, 146
Hin1II	CATG	2 cut(s)	143, 151
Hpy166II	GTNNAC	1 cut(s)	7
Hpy8I	GTNNAC	1 cut(s)	7
Hsp92II	CATG	2 cut(s)	143, 151
MboII	GAAGA	1 cut(s)	70
MhlI	GDGCHC	1 cut(s)	88
MluCI	AATT	2 cut(s)	50, 101
MslI	CAYNNNNRTG	2 cut(s)	122, 138
NlaIII	CATG	2 cut(s)	143, 151
RsaI	GTAC	1 cut(s)	8
RsaNI	GTAC	1 cut(s)	7
RseI	CAYNNNNRTG	2 cut(s)	122, 138
SduI	GDGCHC	1 cut(s)	88
SetI	ASST	1 cut(s)	74
SgeI	CNNG	1 cut(s)	32
SmiMI	CAYNNNNRTG	2 cut(s)	122, 138
Sse9I	AATT	2 cut(s)	50, 101
TasI	AATT	2 cut(s)	50, 101
TatI	WGTACW	1 cut(s)	6
TspDTI	ATGAA	1 cut(s)	136

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.